Please let me know the thermocylin parameter for amplification of
pncA gene in MTB using following primer set if any one use this
pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4 (GTGTCGTAGAAGCGGCCGAT) primers
Dear Chamila, I have analyzed your sequences with IDT oligoanalyzer tool. It seems that Ta is about 60-62oC. But I strongly recommend you to optimize Ta during gradient with points of Ta 56 58 60 62 64. I propose you 2 protocols for optimization. It depends on your choice regarding count of steps.
1. 2 step PCR.
- 95oC 3 min (without hot start ferment)
30 cycles
- 95oC 5 sec
- temperature gradient that includes mentioned ToC 60 sec (time depends on your fragment size; you can use 60 sec up to 500 bp).
72oC for 3 min
2. 3 step PCR
- 95oC 3 min (without hot start ferment)
30 cycles
- 95oC 5 sec
- temperature gradient that includes mentioned ToC 10 sec
- 72oC 60 sec (up to 1000 bp)
72oC for 3 min
taking into acount your primers self and heterodimers you can lost some molecules thats why I recommend You to use 500nM of each primer.
From the strt You can use master mix with all including option. But for more precision optimization use also Mg gradient too.
There are a bunch of free online tools. Here are a few:
https://www.thermofisher.com/us/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html
https://tmcalculator.neb.com/#!/main
http://biotools.nubic.northwestern.edu/OligoCalc.html
Its look like your annealing temperature could be 61 following according to Thermofisher:
Primer#1 AAGGCCGCGATGACACCTCT (Tm- 65.9)
Primer#2 GTGTCGTAGAAGCGGCCGAT (Tm- 64.0)
you can use the following the PCR profilr as:
1. Pre-incubation - 95 degree for 5 min
2. Denaturation - 95 degree for 1 min
3. Annealing - 61 degree for 1 min, but could be more time depends on your product size 1 min is enough up to 1 kb
4. Elongation - 72 degree for 2 min
5. Final elongation - 72 degree for 5 min
Step 2 - 4 needs to repeat for 35 cycle.
- Badges
- Science method