Chamila Adhikaram

3 Questions 4 Answers 0 Followers

Questions related from Chamila Adhikaram

Regarding WGS analysis?

Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation

14 September 2020 2,715 2 View

Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

26 June 2019 9,241 3 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

I am using cleaned PCR product of fragment of rpoB gene of M.tuberculosis. PCR products are cleaned by Exo-Sap and after cycle sequencing purification is done by the sodium acetate method.

07 March 2016 7,970 5 View