5 Questions 5 Answers 0 Followers
Questions related from Chamila Adhikaram
Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation
14 September 2020 2,746 2 View
Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...
26 June 2019 9,272 3 View
I am trying to use genemapper 4 for analysis MIRU-VNRT typing of M. tuberculosis. But, I can insert only 1-9 repeats in the Bin.If some one use genemapper for Tuberculosis typing please help me.
30 March 2016 803 0 View
I am using cleaned PCR product of fragment of rpoB gene of M.tuberculosis. PCR products are cleaned by Exo-Sap and after cycle sequencing purification is done by the sodium acetate method.
07 March 2016 8,004 5 View
Hello What will be the optimum sample no of MTB in WGS using Miseq V3x600
01 January 1970 411 0 View