Chamila Adhikaram

5 Questions 5 Answers 0 Followers

Questions related from Chamila Adhikaram

Regarding WGS analysis?

Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation

14 September 2020 2,726 2 View

Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

26 June 2019 9,253 3 View

Regarding MIRU-VNTR typing?

I am trying to use genemapper 4 for analysis MIRU-VNRT typing of M. tuberculosis. But, I can insert only 1-9 repeats in the Bin.If some one use genemapper for Tuberculosis typing please help me.

30 March 2016 786 0 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

I am using cleaned PCR product of fragment of rpoB gene of M.tuberculosis. PCR products are cleaned by Exo-Sap and after cycle sequencing purification is done by the sodium acetate method.

07 March 2016 7,981 5 View

Regarding Illumina WGS

Hello What will be the optimum sample no of MTB in WGS using Miseq V3x600

01 January 1970 396 0 View