Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

25 June 2019 9,185 3 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

06 March 2016 7,888 5 View

What is the best software to get Phonon DOS from VACF of the a MD simulation?

nMOLDYN has the capability to use the velocity auto correlation function to obtain the phonon density of state for an NVT simulation. There are problems with normalization of the spectra. Does...

10 March 2014 9,647 3 View

What degree of missing data in a particular case/participant results in Expectation-Maximisation no longer working?

I'm dealing with a mediation model and am using the PROCESS module in SPSS. Due to SPSS and PROCESS being limited in the imputation methods - being unable to handle multiple imputation - the other...

02 March 2021 4,362 1 View

Is There Any Feasible Method To Test Fluorescent Compounds Other Than Fluorescence Spectrometers ??

Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !

02 March 2021 5,785 3 View

Mixed ANOVA - help?

I'm currently working on a piece which asks to conduct an ANOVA - looking at the effect of sporting group (2 levels), and exercise trials (two trials with six levels). I've computed this all...

27 February 2021 9,626 4 View

How to Interpret Partial Eta Squared Numbers For a Repeated Measures Anova?

I have obtained Partial Eta Squared Numbers through Two-Way Mixed Anova Analysis. My results for different constructs are: .105, .135, .038, .068, .061 respectively. I wanted to know, whether...

24 February 2021 7,122 1 View

Interpretation of Goodman - Kruskal Gamma squared?

Dear colleages, Eta squared is dominantly used in reflecting the explaining power the same manner as a squared partial correlation coefficient (R2p ) from multiple linear regression: as the...

22 February 2021 7,801 3 View

Interpretation of a fluorescence Emission spectrum ?

Hello, i work with a spectrometer which only render the fluorescence emission spectrum. Until now i just found how to interpret an exitation- and emission spectrum together to generate deeper...

20 February 2021 1,291 3 View

In CDA analysis we have three stages, viz., description , interpretation, and reproduction. Why have all CDA studies neglected the third stage?

In CDA analysis we have three stages, viz., description , interpretation, and reproduction. Why have all CDA studies neglected the third stage?

18 February 2021 6,483 3 View

How can I interpret a ratio variable?

Dear colleagues, I am running a regression in which I have the following regression FoodExp = 67.04 DepRatio +.....e My interest is in the interpretation of the coefficient on the dependency...

16 February 2021 2,058 2 View

How do you interpret theoretical vs. experimental reaction orders with respect to a reactant?

I recently came across a paper focusing on the hydrodeoxygenation of oxygen-containing compounds. The paper linearized the rate equation in order to determine the experimental reaction order with...

14 February 2021 8,254 2 View

Can i use the " weight moisture" ( humidite ponderale in French) of plants to describe their efficiency in using water?

Weight moisture is : water content/ dry weight , if for example it is 4 it means that this plant have for each 1gam of dry mass 4 grams of water. can i use this to interpret the plant use of...

14 February 2021 5,784 1 View