Regarding WGS analysis?

More Chamila Adhikaram's questions See All

How to select research sample scientifically?

population is 100000, they in 250 1AB, 1C category of schools in 3 district. I want select the sample considering school category, district, and gender equality . how many unite should I select?...

08 October 2023 3,047 0 View

Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

25 June 2019 9,278 3 View

Can we evaluate CRISPR/Cas9 Knock-in efficiency by q-PCR?

CRISPR/Cas9-mediated HDR-induced Knock-in (KI) in zebrafish seems to yield very low efficiency in germ-line transmission. To obtain a higher efficiency, we may need to optimize several factors...

02 March 2019 2,930 5 View

Can someone explain the ontology and epistemology in simple way?

the ontology and epistemology is complex phenomenon to understand the nature of research. In my case i need to understand both regarding with my research. So need to understand the simple meaning...

16 February 2017 4,303 90 View

Regarding MIRU-VNTR typing?

I am trying to use genemapper 4 for analysis MIRU-VNRT typing of M. tuberculosis. But, I can insert only 1-9 repeats in the Bin.If some one use genemapper for Tuberculosis typing please help me.

29 March 2016 807 0 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

I am using cleaned PCR product of fragment of rpoB gene of M.tuberculosis. PCR products are cleaned by Exo-Sap and after cycle sequencing purification is done by the sodium acetate method.

06 March 2016 8,011 5 View

Can a fluorescent chimera protein give fluorescent signal even if it is misfolded?

I fused mCherry into the C-terminus of transferrin receptor (TfR) which is a type-2 transmembrane protein (2292bp). So, mCherry supposed to express out side of the cell. During the confocal...

02 June 2015 1,820 5 View

Does activated mouse T cells express MHC class II?

Although there are several lines of evidences suggesting the expression of MHC class II in activated mouse T cells the acceptance seems to be controversial. Please help me for any confirmation...

30 September 2014 8,541 7 View

What is the best software to get Phonon DOS from VACF of the a MD simulation?

nMOLDYN has the capability to use the velocity auto correlation function to obtain the phonon density of state for an NVT simulation. There are problems with normalization of the spectra. Does...

10 March 2014 9,735 3 View

Regarding Illumina WGS

Hello What will be the optimum sample no of MTB in WGS using Miseq V3x600

01 January 1970 416 0 View

Using OBD technique i am trying to measure laser induced shockwaves velocity i found that at start velocity increases and then decay?

i am unable to interpret why its increases in start as shown in figure

11 August 2024 2,179 1 View

How can I interpret the data without the need of solving it manually?

How can I interpret the data gathered without solving?

03 August 2024 9,054 3 View

Why only alpha wave of brain are found in some patients?

I have found an EEG where only alpha waves are present. Beta waves are not found in active patients. What interpretations ?

26 July 2024 4,741 1 View

How to interpret results of AST for Pseudomonas aeruginosa?

While doing AST for Pseudomonas aeruginosa, after incubation, no zone of inhibition observed in the plate near the well. wells surrounded by bacterial growth, when the same plate observed under UV...

25 July 2024 9,229 1 View

Does anyone know the scoring and interpretation for Psychological Birth Order Inventory (PBOI) of White Campbell?

Hi, I am currently a upcoming 4th year student who is need of your help as I couldn't find any accessible file for the manual scoring and interpretation for the PBOI - White Campbell. My group and...

23 July 2024 2,269 1 View

Can you please interprete this analysis?

This is a analysis on IHC scoring of WNVs and USUV performed with culex pipiens

22 July 2024 1,880 0 View

Correct statistical approach for a hermit crab shell exchange experiment?

Hello, I'm planning a shell exchanging experiment with two marine, hermit crab species inside of a tank. I only have one tank available for this experiment. I plan on running 30-40 shell...

20 July 2024 5,676 3 View

How to interpret a Low R squared and negativ adj. R on my fixed effects panel analysis?

Hi guys, in the context of my master thesis i analyze the statistical relationship between income and subjective well-being (Panel: SOEP, n: 300.000 observations over 10 years). After creating a...

13 July 2024 7,539 6 View

Reality Bounded VS Mathematical Bounded toward interpreting mathematic solution?

btw have u ever know about math bounded and reality bounded? for example it happen when student interpret the solution of problem toward mathematics. if you have experience or research about that,...

03 July 2024 6,631 2 View

I want to interpret data of FTIR graph ?

Please someone suggest what can be best option as i dont have knowledge in this field It is data present in graph form of ayurvedic herb

03 July 2024 7,208 0 View