Regarding WGS analysis?

Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation

13 September 2020 2,642 2 View

Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

25 June 2019 9,185 3 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

06 March 2016 7,888 5 View

What is the best software to get Phonon DOS from VACF of the a MD simulation?

nMOLDYN has the capability to use the velocity auto correlation function to obtain the phonon density of state for an NVT simulation. There are problems with normalization of the spectra. Does...

10 March 2014 9,647 3 View

Has anyone used the Illumina ITS1 primer sets?

Hi everyone, Illumina provides a list of primers to amplify with high taxonomic coverage the ITS1 region for further fungal sequencing, but I cannot find the exact amount necessary of each...

25 February 2021 6,969 3 View

Can I use FLEXBAR to detect and remove barcodes out of my short reads without demultiplexing ?

Hello, I have demultiplexed my short reads and I have removed the Illumina adapter left in the sequences and now I need to remove the barcodes used by the sequencing centre from my reads. I have...

22 February 2021 9,873 3 View

Qiime2- No reads passed the filter. How to set the trunc value?

Hi, I am working on some 16S sequencing data, and seems some of them are low quality. I am not sure how to set the trunc value in dada2. qiime dada2 denoise-paired \ --i-demultiplexed-seqs...

30 January 2021 6,213 3 View

Cutoff for asv reads?

I got my fungi sequences back from Illumina Miseq sequencing and I'm wondering how many reads do you use as a cutoff? ie. do you delete anything with less than 100 reads? I can't seem to find any...

28 January 2021 5,646 4 View

How do I get ConsistencyDupSNP.sh file required for genotype consistency quality control step of genotyping data obtained from GSA 24 v2.0 ?

Genotyping data is from Illumina Global screening array 24 v 2.0 and ConsistencyDupSNP.sh file contains list of pair of duplicated SNPs in GSA24 v 2.0.

18 December 2020 1,966 3 View

Could anybody provide insights the best tools to create a custom database for taxonomy assignment of metagenomic data?

I am interested in the different tools that can be used to create custom databases for targeted sequencing and how to trim the databases based on the amplicon size? Also, should custom databases...

02 December 2020 3,105 3 View

Format Mothur database to run through dada2?

I am looking to run illumina miseq data through dada2, but the limited identification of this gene means there are no pre-build databases. I have a database built in MOTHUR format, does anyone...

30 November 2020 8,228 3 View

How do I transform the "Transcripts" into the "Gene symbol"?

I downloaded the expression matrix data "GSE143416_Brain_data_TPM.txt.gz" of GSE143416 from Gene expression omnibus ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi). However, the first column of...

30 November 2020 1,304 3 View

How do you design heterogeneity spacers for primers in amplicon metagenomic studies?

Adding heterogeneity spacers to primers used for Illumina based amplicon studies has proven to improve read quality by increasing bp diversity on the flow cell during sequencing. I have seen two...

01 November 2020 9,071 3 View

Illumina vs. BGI/MGI, MGISEQ-T7 vs. NovaSeq 6000, which to choose?

I am looking for opinions/recommendations of NGS Platforms (Illumina vs. BGI/MGI) from people that had opportunity to work on both hardware: MGISEQ-T7 and NovaSeq 6000 or analyze data from both....

04 October 2020 8,125 1 View