Hello
What will be the optimum sample no of MTB in WGS using Miseq V3x600
population is 100000, they in 250 1AB, 1C category of schools in 3 district. I want select the sample considering school category, district, and gender equality . how many unite should I select?...
08 October 2023 3,047 0 View
Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation
13 September 2020 2,751 2 View
Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...
25 June 2019 9,278 3 View
CRISPR/Cas9-mediated HDR-induced Knock-in (KI) in zebrafish seems to yield very low efficiency in germ-line transmission. To obtain a higher efficiency, we may need to optimize several factors...
02 March 2019 2,930 5 View
the ontology and epistemology is complex phenomenon to understand the nature of research. In my case i need to understand both regarding with my research. So need to understand the simple meaning...
16 February 2017 4,303 90 View
I am trying to use genemapper 4 for analysis MIRU-VNRT typing of M. tuberculosis. But, I can insert only 1-9 repeats in the Bin.If some one use genemapper for Tuberculosis typing please help me.
29 March 2016 807 0 View
I am using cleaned PCR product of fragment of rpoB gene of M.tuberculosis. PCR products are cleaned by Exo-Sap and after cycle sequencing purification is done by the sodium acetate method.
06 March 2016 8,011 5 View
I fused mCherry into the C-terminus of transferrin receptor (TfR) which is a type-2 transmembrane protein (2292bp). So, mCherry supposed to express out side of the cell. During the confocal...
02 June 2015 1,820 5 View
Although there are several lines of evidences suggesting the expression of MHC class II in activated mouse T cells the acceptance seems to be controversial. Please help me for any confirmation...
30 September 2014 8,541 7 View
nMOLDYN has the capability to use the velocity auto correlation function to obtain the phonon density of state for an NVT simulation. There are problems with normalization of the spectra. Does...
10 March 2014 9,735 3 View
I am working on a dataset of MHC-I and II alleles from a bird species sequenced with Illumina. We were not able to assign alleles to loci through MHC-typer as we were over the limit of 150 alleles...
15 July 2024 182 1 View
I recently acquired a used Illumina HiSeq 2500 and am in need of flow cells compatible with this machine. As I am relatively new to this aspect, I would greatly appreciate any recommendations on...
22 June 2024 5,992 1 View
I want to perform PacBio RNA-seq of a filamentous fungal isolate during multiple infection time-points in barley leaf. I was told that PacBio RNA-seq would not be viable due to the low...
12 June 2024 4,027 1 View
Hello everyone, I am starting a soil mapping project in a specific crop region, and my goal is to perform shotgun sequencing (Illumina NovaSeq) to identify microorganisms and potential genes. This...
24 May 2024 5,021 4 View
Hello! I am trying to analyze some RNAseq data I recently received. I would like to craft a heatmap comparing the expression of specific genes across my cell samples, but I am not sure which of...
08 May 2024 5,665 0 View
Dear community, I'm inputting data from an old GWAS study based on the Immunochip array, and I need the annotation file to conduct a few QC steps. I can't find it on the Illumina website; I...
06 April 2024 8,979 2 View
I recently performed Illumina shotgun sequencing and my fastqc data is as attached. is this correct?
01 April 2024 3,354 6 View
Ran out of RT in Illumina mRNA prep Kit, unfortunately the company doesn't sell it separately; plan to substitute it with Superscript III. Does anyone done that before? Will it work?
20 February 2024 1,284 0 View
Good day everyone. I'm working with eDNA Metabarcoding for freshwater fishes in Brazil, I ran tests amplifying positive controls and samples with the primer MiFish-U (Miya et al 2015) alone (no...
11 January 2024 5,109 2 View
Hi, We have been doing Illumina kit-based NGS using Miseq 2. We had the analysis tool. However, for interpretation, we used the Illumina BaseSpace Variant Analyzer. Now they are discontinuing...
21 December 2023 1,073 0 View
