Regarding MIRU-VNTR typing?

30 March 2016 0 808 Report

I am trying to use genemapper 4 for analysis MIRU-VNRT typing of M. tuberculosis. But, I can insert only 1-9 repeats in the Bin.If some one use genemapper for Tuberculosis typing please help me.

Badges
Science topic

More Chamila Adhikaram's questions See All

How to select research sample scientifically?

population is 100000, they in 250 1AB, 1C category of schools in 3 district. I want select the sample considering school category, district, and gender equality . how many unite should I select?...

08 October 2023 3,047 0 View

Regarding WGS analysis?

Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation

13 September 2020 2,751 2 View

Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

25 June 2019 9,278 3 View

Can we evaluate CRISPR/Cas9 Knock-in efficiency by q-PCR?

CRISPR/Cas9-mediated HDR-induced Knock-in (KI) in zebrafish seems to yield very low efficiency in germ-line transmission. To obtain a higher efficiency, we may need to optimize several factors...

02 March 2019 2,930 5 View

Can someone explain the ontology and epistemology in simple way?

the ontology and epistemology is complex phenomenon to understand the nature of research. In my case i need to understand both regarding with my research. So need to understand the simple meaning...

16 February 2017 4,303 90 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

I am using cleaned PCR product of fragment of rpoB gene of M.tuberculosis. PCR products are cleaned by Exo-Sap and after cycle sequencing purification is done by the sodium acetate method.

06 March 2016 8,011 5 View

Can a fluorescent chimera protein give fluorescent signal even if it is misfolded?

I fused mCherry into the C-terminus of transferrin receptor (TfR) which is a type-2 transmembrane protein (2292bp). So, mCherry supposed to express out side of the cell. During the confocal...

02 June 2015 1,820 5 View

Does activated mouse T cells express MHC class II?

Although there are several lines of evidences suggesting the expression of MHC class II in activated mouse T cells the acceptance seems to be controversial. Please help me for any confirmation...

30 September 2014 8,541 7 View

What is the best software to get Phonon DOS from VACF of the a MD simulation?

nMOLDYN has the capability to use the velocity auto correlation function to obtain the phonon density of state for an NVT simulation. There are problems with normalization of the spectra. Does...

10 March 2014 9,735 3 View

Regarding Illumina WGS

Hello What will be the optimum sample no of MTB in WGS using Miseq V3x600

01 January 1970 416 0 View

What is the best sampling strategy?

I am conducting a qualitative study that uses interviews to investigate the perceptions of teachers about a particular leadership practice and I am focusing on 3 schools which have a total number...

01 August 2024 8,457 10 View

Is it possible to do transient simulation in HFSS in presence of magnetic biasing?

I have designed magnetic material with different biasing conditions in HFSS. Now I want to give an RF AC signal and do a transient simulation in HFSS. Is it possible to do in HFSS? Please help me...

24 July 2024 9,319 5 View

ANCOVA for between-subject design?

Hi, I will run an experiment where reaction time will be the dependent variable, tested in 2 conditions (with the same participants). I want to control for a confounding variable (individual...

20 July 2024 1,943 1 View

I am working on III-V based tandem solar cells.Can anyone explain that solar cells work under forward or reverse biased conditions?

I want to know that n-doped side of solar cell is connected with positive or negative electrode.

20 July 2024 1,348 2 View

Charge transfer characteristics of inverted perovskite leds?

When testing devices based on ITO/ZnO/CsPbBr3/TFB/MoO3/Ag structures, I found that the current density of the device always increases sharply to 1000mA/cm2 at about 3V bias, and the device does...

16 July 2024 4,291 0 View

How can I extract the mathematical equation from existing Neural Network Model?

There exists a neural network model designed to predict a specific output, detailed in a published article. The model comprises 14 inputs, each normalized with minimum and maximum parameters...

14 July 2024 2,714 3 View

Can ROBINS-I be used to measure risk of bias in single-arm studies?

I am doing a systematic review, and I am measuring risk of bias with RoB2 for RCT, and ROBINS-I for non RCT. My questions is, for single arm studies, can I use ROBINS-I? I am not sure how to...

14 July 2024 3,570 5 View

I'm looking for a tool to evaluate the risk of bias in... Are there any recommended applications or platforms?

Dear researchers, In a systematic review (not a meta-analysis) compiling studies on various diagnostic systems against a specific pathogen. The most relevant parameters evaluated are the type of...

03 July 2024 9,069 3 View

Can I do IPTG induction on OD600=2.6 in TB?

I have been looking at papers for protein expression and trying to follow the process. I'm using TB medium to do the process, and the paper says to grow to an OD600 = 1.8 at 37 degrees, then let...

30 June 2024 6,502 5 View

Marker gene metagenome sequencing?

The source of classification bias in marker gene metagenome sequencing? a variability in the taxonomy classification of microbial communities when using different primer pairs (e.g. for 16S rDNA)...

29 June 2024 1,048 1 View