Regarding WGS analysis?

Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation

13 September 2020 2,642 2 View

Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

25 June 2019 9,185 3 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

06 March 2016 7,888 5 View

What is the best software to get Phonon DOS from VACF of the a MD simulation?

nMOLDYN has the capability to use the velocity auto correlation function to obtain the phonon density of state for an NVT simulation. There are problems with normalization of the spectra. Does...

10 March 2014 9,647 3 View

I got 02 moderator values defining Johnson-Neyman significance regions. Is it an error?

Hi everyone, I am conducting research for my Master's thesis. I am using PROCESS by Johnson-Neyman to analyze my Moderator model. I test the relationship between Public Service Motivation and...

03 March 2021 2,350 2 View

What are the patterns of human behavior that lead to COVID-19 infections?

Does data from contact tracing help in establishing patterns of behavior and social interactions that lead to infections? There are cases here in the Philippines where patients have no travel...

25 February 2021 9,002 13 View

Cells not growing in large scale protein expression?

I am using KRX cell. I have grown my overnight cultures at 37 degrees. When I inoculate 1L TB media, my cells do not grow. I have also tried using 25 degree incubation of overnight cultures and...

10 February 2021 3,871 3 View

Can any scholar assist me with an r code for calculating average bias for each parameter of a continuous distribution via simulation?

I want to perform a simulation study to examine the consistency property of parameters of a new distribution through the quantile function. The simulation study will contain many replicates (say...

10 February 2021 180 3 View

Should we analyze or relinquish the clinically confirmed data of COVID-19?

Hello everybody As you know, due to the high cost and time-consuming of laboratory assays, like PCR, for the suspected cases of COVID-19, doing this type of investigation is not possible for all...

06 February 2021 6,122 3 View

Is a Strong correlation between the Moderator variable and the dependent variable an issue for moderation model (model 1) in Hayes PROCESS?

In a typical moderation model with one moderator, is it a problem if the moderator and the dependent variable show a strong correlation (say 0.85)? What if a strong correlation exists between the...

27 January 2021 4,937 4 View

Does the power law behavior can be approximated with Gaussians?

In epidemiology, earthquakes, tokamak disruptions etc., there is possibility of approximations with the sequence of Gaussians and with the appropriate risks ( see my papers in Journal of Fusion...

26 January 2021 5,411 5 View

Any method or procedure of parameters estimation for epidemiological mathematical modeling?

As in the image below, may someone help us on how to estimate the parameters used on epidemiological mathematical modeling described in systems of non linear differential equations? Any possible...

22 January 2021 2,869 3 View

How to calculate the CFU/ml for Mycobacterium tuberculosis growing in 7H9 broth?

I am running an experiment in which I need to calculate the CFU/ml of a Mycobacterium tuberculosis growing in 7H9 broth. Is there a reliable method to calculate cfu/ml for MTB since a culture of...

22 January 2021 10,027 2 View

How to analyze non-independent epidemiological data using SPSS?

For my epidemiological data, I have used SPSS and done multiple imputation (MI) to account for the missing information. Now, I am about to analyze my data, but the issue is, that not all...

21 January 2021 3,355 7 View