An issue during amplification of H.pylori resistant genes A2142C, GyrA(271T),GyrA(272G), GyrA(261G) and GyrA(271A)

01 January 1970 0 3K Report

Hello,

I have ordered A2142C, GyrA(261A), GyrA(271T),GyrA(272G), GyrA(261G) and GyrA(271A) primer probes in this literature separately.

Article Evaluation of multiplex ARMS-PCR for detection of Helicobact...

I ran a clean PCR but I see unspecific amplification for A2142C in all reaction wells and NTC which is not changed flatted by dilution of primer probe.(attachment 1)

I also see amplification for GyrA(271T),GyrA(272G), GyrA(261G) and GyrA(271A) in H.pylori ATCC-43504 and H.pylori ATCC-700392 (26695) that do not contain levofloxacin resistant genes based on other studies.

-Are these issues duo to using ARMS PCR primer probes in real time PCR?

-or ATCC strains are not pure?

-What is the problem?

Badges
Science method

More Hesam Mahmodi's questions See All

How to calculate the distance between points in Qgis?

I have a shape file containing almost 3000 points and a delimited text layer with almost 500 points. What I want to do is to calculate the distance between each 500 points and the nearest point to...

06 July 2020 3,709 10 View

Dear Researchers and scholars, Please, guide and inform on Reporting one Journal in Africa (Nigeria) and its editors?

Dear Respected Researchers and Scholars Greetings. I and one of my Chinese colleague have received Acceptance Letters with Official Invoice from one Journal in Africa (Nigeria), and we did pay...

26 April 2020 2,225 20 View

Why significant melt peak cannot be observed for the unknown samples in qPCR targeting 16s rRNA?

I'm doing qPCR targeting 16s rRNA with the primers 337F and 518R. The standard curve looks fine. The problem is the melting peak of the environmental samples of unknown bacterial composition. They...

07 May 2019 6,689 16 View

How to create a heat map?

I have some geospatial data points (X and Y in decimal degrees) and the concentrations of a certain parameter for each point. I want to create a heat map to show the density of the concentrations...

30 April 2019 9,127 9 View

Why do I observe smearing in agarose gel while using purified PCR product?

I did the plasmid extraction, and ran the PCR with my primers... Then, I did the magnetic bead purification to purify the PCR product. In the attached picture you can see smearing in the lane on...

04 April 2019 9,612 6 View

How to choose the best primer pairs for the qPCR, when all their standard curves look fine ?

I am doing qPCR assay targeting intI1 genes, with some waste water treatment plant DNA samples. I used the primer pairs HS463a (CTGGATTTCGATCACGGCACG), HS464 (ACATGCGTGTAAATCATCGTCG), IntI1F165...

26 February 2019 8,388 9 View

How can I combine permeability and diffusion for a reacting flow in a porous catalyst media?

I want to solve a CFD problem. Any suggestions would be great.

24 July 2018 7,986 3 View

Can we use autoencoders or variational autoencoders for function approximation?

As far as I checked the net the autoencoders are used mostly in image or audio application but the question is that can we use them for fitting models?

04 June 2018 5,627 3 View

What are the best image analysis softwares with application in earth sciences?

Does anyone familiar with any image analysis software that can be used for image quantification, particles size and shape determination, image segmentation and classification by color, texture and...

02 December 2017 5,070 19 View

How can I enable a heterogeneous reaction only in specified zone in fluent when my case is consist of more than one zone?

My case involves homogeneous and heterogeneous reactions in porous media. In the cell zone condition panel I can only turn on/off the homogeneous reactions (in each phase) in a zone. When the...

25 November 2015 1,701 1 View

In PRIMER, is it possible to downweight certain taxa in multivariate community datasets to reflect uncertainty around identification??

I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...

03 March 2021 8,066 4 View

How do I increase the yield of my PCR product?

Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...

02 March 2021 4,029 3 View

PACYC PCR not working after several attempts. Would anyone have any suggestions?

So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...

02 March 2021 1,146 2 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

How to calculate the annealing temperature of a primer pair?

I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...

01 March 2021 360 7 View

How to address this issue in the analysis of Real-Time PCR results?

To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...

01 March 2021 8,683 4 View

No title

Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?

01 March 2021 5,311 1 View

Anybody with an idea on how do design specific primers for detecting tomato resistance genes tm-1, TM-2 and Tm2^2?

I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...

28 February 2021 606 3 View

What is the ideal efficiency for a qPCR?

hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?

28 February 2021 1,254 3 View

MiRNA qpcr problem?

Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.

28 February 2021 5,008 4 View