How to calculate the distance between points in Qgis?

I have a shape file containing almost 3000 points and a delimited text layer with almost 500 points. What I want to do is to calculate the distance between each 500 points and the nearest point to...

06 July 2020 3,709 10 View

Dear Researchers and scholars, Please, guide and inform on Reporting one Journal in Africa (Nigeria) and its editors?

Dear Respected Researchers and Scholars Greetings. I and one of my Chinese colleague have received Acceptance Letters with Official Invoice from one Journal in Africa (Nigeria), and we did pay...

26 April 2020 2,225 20 View

Why significant melt peak cannot be observed for the unknown samples in qPCR targeting 16s rRNA?

I'm doing qPCR targeting 16s rRNA with the primers 337F and 518R. The standard curve looks fine. The problem is the melting peak of the environmental samples of unknown bacterial composition. They...

07 May 2019 6,689 16 View

How to create a heat map?

I have some geospatial data points (X and Y in decimal degrees) and the concentrations of a certain parameter for each point. I want to create a heat map to show the density of the concentrations...

30 April 2019 9,127 9 View

Why do I observe smearing in agarose gel while using purified PCR product?

I did the plasmid extraction, and ran the PCR with my primers... Then, I did the magnetic bead purification to purify the PCR product. In the attached picture you can see smearing in the lane on...

04 April 2019 9,612 6 View

How to choose the best primer pairs for the qPCR, when all their standard curves look fine ?

I am doing qPCR assay targeting intI1 genes, with some waste water treatment plant DNA samples. I used the primer pairs HS463a (CTGGATTTCGATCACGGCACG), HS464 (ACATGCGTGTAAATCATCGTCG), IntI1F165...

26 February 2019 8,388 9 View

How can I combine permeability and diffusion for a reacting flow in a porous catalyst media?

I want to solve a CFD problem. Any suggestions would be great.

24 July 2018 7,986 3 View

Can we use autoencoders or variational autoencoders for function approximation?

As far as I checked the net the autoencoders are used mostly in image or audio application but the question is that can we use them for fitting models?

04 June 2018 5,627 3 View

What are the best image analysis softwares with application in earth sciences?

Does anyone familiar with any image analysis software that can be used for image quantification, particles size and shape determination, image segmentation and classification by color, texture and...

02 December 2017 5,070 19 View

How can I enable a heterogeneous reaction only in specified zone in fluent when my case is consist of more than one zone?

My case involves homogeneous and heterogeneous reactions in porous media. In the cell zone condition panel I can only turn on/off the homogeneous reactions (in each phase) in a zone. When the...

25 November 2015 1,701 1 View

Looking for Materials with high thermal expansion coefficient and high temperature resistance?

03 March 2021 8,272 1 View

In PRIMER, is it possible to downweight certain taxa in multivariate community datasets to reflect uncertainty around identification??

I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...

03 March 2021 8,066 4 View

PACYC PCR not working after several attempts. Would anyone have any suggestions?

So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...

02 March 2021 1,146 2 View

How to grow E.coli on the low salt LB agar plate with 50 or 100ug/ml of Blasticidin?

Hello, I would like to ask how to grow E.coli which resists 50 or 100ug/ml of Blasticidin. I have tried many methods by using low salt Luria-Bertain(LB) agar plate. However, no colonies grow. Let...

01 March 2021 2,027 2 View

How to calculate the annealing temperature of a primer pair?

I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...

01 March 2021 360 7 View

Which fluorescent dye to use for measuring total ROS production?

Is DCFDA appropriate for measuring total ROS production, or can it only detect certain types of ROS? If I want to measure total ROS production, which dye should I use?

01 March 2021 9,447 3 View

No title

Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?

01 March 2021 5,311 1 View

Anybody with an idea on how do design specific primers for detecting tomato resistance genes tm-1, TM-2 and Tm2^2?

I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...

28 February 2021 606 3 View

What is the ideal efficiency for a qPCR?

hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?

28 February 2021 1,254 3 View

MiRNA qpcr problem?

Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.

28 February 2021 5,008 4 View