How to calculate the distance between points in Qgis?

I have a shape file containing almost 3000 points and a delimited text layer with almost 500 points. What I want to do is to calculate the distance between each 500 points and the nearest point to...

06 July 2020 3,709 10 View

Is there a referenced dataset for extractive/abstractive single document Summarization ?

is there a referenced dataset for extractive/abstractive single document Summarization?

07 May 2020 4,087 9 View

Dear Researchers and scholars, Please, guide and inform on Reporting one Journal in Africa (Nigeria) and its editors?

Dear Respected Researchers and Scholars Greetings. I and one of my Chinese colleague have received Acceptance Letters with Official Invoice from one Journal in Africa (Nigeria), and we did pay...

26 April 2020 2,225 20 View

Why significant melt peak cannot be observed for the unknown samples in qPCR targeting 16s rRNA?

I'm doing qPCR targeting 16s rRNA with the primers 337F and 518R. The standard curve looks fine. The problem is the melting peak of the environmental samples of unknown bacterial composition. They...

07 May 2019 6,689 16 View

How to create a heat map?

I have some geospatial data points (X and Y in decimal degrees) and the concentrations of a certain parameter for each point. I want to create a heat map to show the density of the concentrations...

30 April 2019 9,127 9 View

Why do I observe smearing in agarose gel while using purified PCR product?

I did the plasmid extraction, and ran the PCR with my primers... Then, I did the magnetic bead purification to purify the PCR product. In the attached picture you can see smearing in the lane on...

04 April 2019 9,612 6 View

How to choose the best primer pairs for the qPCR, when all their standard curves look fine ?

I am doing qPCR assay targeting intI1 genes, with some waste water treatment plant DNA samples. I used the primer pairs HS463a (CTGGATTTCGATCACGGCACG), HS464 (ACATGCGTGTAAATCATCGTCG), IntI1F165...

26 February 2019 8,388 9 View

How can I combine permeability and diffusion for a reacting flow in a porous catalyst media?

I want to solve a CFD problem. Any suggestions would be great.

24 July 2018 7,986 3 View

Can we use autoencoders or variational autoencoders for function approximation?

As far as I checked the net the autoencoders are used mostly in image or audio application but the question is that can we use them for fitting models?

04 June 2018 5,627 3 View

What are the best image analysis softwares with application in earth sciences?

Does anyone familiar with any image analysis software that can be used for image quantification, particles size and shape determination, image segmentation and classification by color, texture and...

02 December 2017 5,070 19 View

error in running a model in Abaqus

Excessive rotation of nodes in node set ErrNodeExcessRotation-Step1

17 August 2021 0 0 View

error in modelling model in Abaqus

Excessive rotation of nodes in node set ErrNodeExcessRotation-Step1

17 August 2021 0 0 View

MGL tools

20 June 2021 0 0 View

How climate change will influences human and animal behavioral change?

The role of climate change influencing the human behavior as well as economics interest

01 June 2021 0 0 View

flexibility of polymers chain

effect of double bond on the flexibility of polymers

07 April 2021 0 0 View

i have some problem with chtMultiRegionSimpleFoam

--> FOAM FATAL ERROR: Maximum number of iterations exceeded From function Foam::scalar Foam::species::thermo::T(Foam::scalar, Foam::scalar, Foam::scalar, Foam::scalar (Foam::species::thermo::*)(Foam::scalar, Foam::scalar) const, Foam::scalar (Foam::species::thermo::*)(Foam::scalar, Foam::scalar) const, Foam::scalar (Foam::species::thermo::*)(Foam::scalar) const) const [with Thermo = Foam::hConstThermo >; Type = Foam::sensibleEnthalpy; Foam::scalar = double; Foam::species::thermo = Foam::species::thermo >, Foam::sensibleEnthalpy>] in file /home/ubuntu/OpenFOAM/OpenFOAM-4.1/src/thermophysicalModels/specie/lnInclude/thermoI.H at line 66. FOAM aborting #0 Foam::error::printStack(Foam::Ostream&) at ??:? #1 Foam::error::abort() at ??:? #2 Foam::heRhoThermo >, Foam::sensibleEnthalpy> > > >::calculate() at ??:? #3 Foam::heRhoThermo >, Foam::sensibleEnthalpy> > > >::correct() at ??:? #4 ? at ??:? #5 __libc_start_main in "/lib/x86_64-linux-gnu/libc.so.6" #6 ? at ??:?

24 March 2021 0 0 View

Formulation of polymer color flakes

I am writing to request some information for making polymer color flakes. I would appreciate the help.

17 March 2021 0 0 View

How to analyze a particular region of my simulation box in GROMACS?

Hi, I am using GROMACS 5.1.4 to simulate water in contact with a surface. I am only interested to calculate some properties of water near the surface. Let's say at a distance of x nm from the...

03 March 2021 9,989 2 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

What is the production process of CaFe ferroalloys?

I looking for ferro calcium production process

03 March 2021 1,755 4 View