The set of PCR primers is as follows: (determined using blast, Specificity:Alteromonas)
Forward primer AACAACACGCATTACACGCC
Reverse primer GTGGCCAAGTGCCATACTCT
Self-complementarity: 2.00 & 6.00, respectively
3" complementarity = 1.00 & 1.00
The set looks like it has suitable Tm velues for both: 60.04
GC% of 50 and 55, respectively.
Their lengths = 20
The product length 461.
The dG values: 27 and 26.2.
Thank you in advance.
Most probably it will work, at least according to my experience You may only run into a lot of funny problems (bands and an awful amout of smear), if you in addition go down to much with your annealing temperature. Just do it - you don't seem to have another choice, do you? What you should definitely do, however, is to end both primesrs with a C or G (if ever possible) and, even more, take care that the 3'-ends really match with the target. In the end, this is much more important than the lengths of the primers. If the 3'-ends do not match, what do you expect that a polymerase can do?
Good luck and courage!
I agree with Johannes with such a small self homology I would not expect problems with self annealing at 60c. If you want to be certain then use a hot start polymerase when even low temperature effects will be minimal
Hi
can you post a link to access the sequence of your target, an environmental point of view (neighbor sequences) should help me to help you.
fred
- Badges
- Science method