4 Questions 6 Answers 0 Followers
Questions related from Olivia Szulikowska
As a part of one of my R&D projects, I had to examine the effect of a set of industrial co-products on the growth of a single microalgal species. I had to prepare (6) flasks containing 100...
11 November 2018 1,413 13 View
I am struggling to find a method to assess the suitability of various carbon sources due to the fact that the carbon sources I am dealing with are quite thick and not clear. I have thought of...
11 November 2018 4,457 5 View
I grew a Pseudoalteromonas sp. on Zobell ZM/1 medium enriched with the following carbon sources: one type with 3% Glucose one type with 3% Tween They were subjected to '' cold-shock''...
04 April 2018 5,778 8 View
The set of PCR primers is as follows: (determined using blast, Specificity:Alteromonas) Forward primer AACAACACGCATTACACGCC Reverse primer GTGGCCAAGTGCCATACTCT Self-complementarity: 2.00 &...
03 March 2017 7,749 3 View