qPCR was done to a gene called 36B4, 20ng of DNA and forward primer with concentration 300 nM and reverse primer of 500nM.qPCR machine used is lightcycler 480. Program used 95 c for 10 minutes, followed by 35 cycles of 95 c (15 sec) , then 52 c for 20 sec and 72 c for 30sec.
Resuspending 36B4 forward primers
o Concentration in (nmol) = 52.2 nmol
o Stock concentration = 100 uM
o Re-suspend oligos in = 522 ul
· Resuspending reverse 36B4 reverse primer
o Concentration in (nmol)=44.9 nmol
o Stock concentration = 100 uM
o Re-suspend oligos in = 449 ul
· Forward Primer working concentration calculations
o Initial concentration = 100 uM
o Working concentration = 2.5 uM
o Working solution volume = 80 ul
o I added 2 ul of primers (100 uM) to 78 ul of H20
· Forward primer Final concentration
o Working concentration = 2.5 uM
o Final concentration = 300 nM
o Final volume =25 ul
o Volume of the primer to be added to 25 ul tube is 3ul
· Reverse Primer working concentration calculations
o Initial concentration = 100 uM
o Working concentration = 2.5 uM
o Working solution volume = 80 ul
o I added 2 ul of primers (100 uM) to 78 ul of H20
· Reverse primer Final concentration
o Working concentration = 2.5 uM
o Final concentration = 500 nM
o Final volume =25 ul
o Volume of the primer to be added to 25 ul tube is 5ul
DNA stock solution calculation
o DNA concentration = 213 ng/ul
o Required working DNA concentration = 10 ng/ul
o Working volume = 40 ul
o I added 1.8 ul of DNA (213 ng/ul) to 38.2 H20
· DNA final volume concentration
o DNA concentration = 10 ng/ul
o Required mass = 20 ng
o I added 2 ul
Calculation for 1 reaction of 25 ul volume
DNA 2 ul (20 ng)
Forward primer 3 ul (300 nM)
Reverse primer 5 ul (500 nM)
Sybergreen mastermix 12.5 ul
H20 2.5 ul
Do you quantify your sample with the nanodrop for RNA and cDNA? Nano drop readings may be deceiving. You should use the Quibit to confirm if you have intact RNA and DNA. The probe that you use for the Quibit is only going to stacked to the intact RNA or DNA. We had the same problem in our lab and with the Quibit we found out that we did not have intact RNA to begin with.
I agree a screen shot is necessary and the melt curve, if you have run one. If not, have you run the product out on a gel to see if you have any product?
Still too many open questions:
WHAT DO YOU MEAN WITH ZIG-ZAG? I assume you have something that´s close to baseline and hence no amplification.
FIRST OF ALL: is 36B4 the only gene giving you trouble? (assuming you are using cDNA)
IF YES:
*have you checked that the primer sequences are OK (alignment to your template, sometimes primers present in a lab database are messed up, are from another organism (e.g. mouse vs human), so better check before use)
*with the alignment (see above) make sure that the product size is reasonable: between 90-500 bp (larger is possible too, but the recommendation for qPCR is as short as possible to reduce the risk of secondary structures that decrease amplification efficiency etc).
*try other primers. e.g. these, they worked for me on mouse cDNA (200 ng for 20 uL RT setup; 50x diluted cDNA, 5 uL used in 20 uL qPCR) with ABI SYBR green system - annealing at 60°C;
FWR GCGACCTGGAAGTCCAACTA
REV ATCTGCTGCATCTGCTTGG
IF you only tried 36B4: try other genes.
IF other genes failed you have to give more info:
TEMPLATE: cDNA or a PCR product or on genomic DNA
IF cDNA:
*check your RNA quality (on a gel if you have no Quibit - we don´t have it) - how do you extract it, from which source (some tissues, e.g. duodenum/digestive system needs to be flash frozen ASAP and should at no point between storage and disruption/lysis be allowed to thaw; actually true for all tissues for best RNA quality)
*how do you purify the RNA, how much do you use for RT, what are your settings for RT ...
IF gDNA or PCR product/Plasmid:
-make sure your primers can anneal and in case of gDNA: maybe your primers were designed to work with cDNA and are intron spanning, when using gDNA the product may be too large to be produced efficiently.
Without a screenshot, my best guess is that you have either:
1) No amplification at all. Check to see if your reaction amplified by running out some of your product on an agarose gel. Make sure your SYBR mastermix hasn't expired, been frozen & thawed too many times, etc. Did you get amplification from a positive control?
2) Really bad pipet technique.
@all: and this is a good example of the value of a local supervisor - trouble shooting through internet should probably be the last step, when the local team runs out of ideas. So all you students: bug your supervisors, it´s their job, they are paid to train you, and of course, you yourself should critically go through your data, procedures etc :-)
@Jean Neil: thanks for sharing the solution.
the best andwer is, there had any amplification. So you shoud check your primer sequences or PCR conditions again
Hi, I think you have contamination in your reaction and check every thing especially your D.D.W. the ZigZag bands are very common in the case of contamination.
- Badges
- Science topic