I am using CRISPR/CAS9 system to knockout genes in rice. I have successfully used to knockout other genes. There is problem with only one gene. After checking and double checking, I see nothing wrong with my construct. I can detect the presence of the CAS9 plasmid in rice seedlings (using PCR) but the target gene is not mutated. Loss of function of the gene is not lethal as the same gene is successfully knocked out in Arabidopsis or at least I could get heterozygous plants, but i did not get any. The details of my constructs are given below. Your suggestions will be highly appreciated. Thanks!
---
Target genes (The target regions are shown in BOLD)
A-----CGAGGCCGCCCGAAGACTCCGACAAGAAGGTTTACCTCCCTTTGCAG------
B-----TCAAGGATGTGGAGATCAGTTTCCCAATTGTCTATGGAACCATTTCTTTCTG---
gRNA Constructs (The first 4 bases are the sticky ends for cloning)
A
GGCATTCTTGTCGGAGTCTTCGGG
AAACCCCGAAGACTCCGACAAGAA
B
GGCAATCAGTTTCCCAATTGTCTA
AAACTAGACAATTGGGAAACTGAT
I am assuming those are your primers. I am not sure which plasmid you are putting these into, but it seems you are adding an extra 2 bases compared to most published strategies, and 4 extra bases that don't correspond to your target site. Using DR274, myself and others have added "TA" to the F primer, and "AAAC" to the R primer *while simultaneously removing "CC" from the end of the R primer* -- you are simply adding 4 bases to both primers to create your sticky ends, which means that "GGCA" will be at the 5' end of your sgRNA (if I am right about your cloning strategy and that you are using T7 RNAP), but this motif does not appear to be part of your target site.
Table 1 of this paper has some examples. It also spells out how the 'GG18N(NGG)' target site constraint is reflected in primer and guide RNA template design/creation.
Article Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis
- Badges
- Science method