So for the last couple of months I've been trying to produce cDNA from mouse tissue. My goal was to get a positive control cDNA that I was going to get from extracting and reverse transcribing RNA from a mouse tissue which is well known for expressing the gene (KCNQ4 in the inner ear). I was also going to check it with housekeeping genes.

I used Transzol, a trizol like reagent and carried a manual extraction, which turned out well judging by the fact that it had a concentration of about 500ng/ul, a A260/280 ratio of 1.8 and two clear ribosomal bands on an agarose gel. There was also a high molecular weight band up on top which I think was due to genomic DNA contamination. RNA extraction was done by quickly extracting the temporal bones from the skull, obtaining the bony otic capsule which houses the inner ear, the tissue in which my gene is expressed (completely validated, we even use inner ear slides for positive controls in inmunochemistry). I then crushed the otic capsule under liquid nitrogen on a mortar, sunked the remains on a ml of Transzol and gave more homogenizing with a pestle homogenizer on a 1.5 eppendorf tube.

The manual extraction was done with chloroform, precipitation with ethanol and cleansing with 75% ethanol, dissolving the pellet in water without problems. The RNA quality was good as far as I know (concentration, A260/280, agarose gel). The only problem was the gDNA contamination. So just before doing the RT reaction I treated the samples with DNAseI. EasyScript was the RT enzyme I was using and after finishing I probed the samples, which had -RT controls (the only thing missing in them was the RT enzyme, I mastermixed my way up until the enzyme).

Probing the samples on a PCR reaction with housekeeping genes like GAPDH turned out great, I only had bands of the specific size (141bp) on the +RT samples. None of the -RT showed any bands, nor did the NTC controls. So far so good.

But when using the primers for my transcript it won't show up, and what was puzzling was that it did tuned up on a cDNA sample brought from germany (I'm not sure if it had a DNAseI treatment, but the primers were working on something). We went about trying to do things better or using other enzymes and it hasn't changed the results.

My pI bought a RNA kit (Direct-Zol from Zymo) and an expensive RT enzyme (UltraScript II from genbiotech). The RNA extraction included a DNaseI treatment on column. The results where good, with less RNA concentration, but it was workable (200-500 ng/ul), 1.8 A260/A280 ratio. And the gel showed the two ribosomal bands

https://drive.google.com/file/d/0B7WtkMWfYxrpTnNBWUpTYUVuSjQ/view?usp=sharing

For comparison, this is how the RNA looked after manual extraction:

http://i.imgur.com/t7t5rDb.jpg

Things got worse when I tried to do reverse transcription of the RNA extracted with Direct-Zol. EasyScript and UltraScribe (using oligoDT or random primers) gave samples which turned the same result when probing with housekeeping genes on a PCR. +RT and -RT showed a signal, the NTC did not, seeming like some gDNA remained, maybe the DNase treatment on the column wasn't sufficient. It's fair to point out that this pair of primers should be transcript-specific because they span an exon-exon junction. But I've found blasting them on a genomic DNA context, it turns out it produces the same exact band on multiple undescribed regions on chromosome 1, looking like the GAPDH transcript is cloned into genomic DNA. Weird stuff.

I'm at odds with this technique. KCNQ4 is constitutively expressed in the inner ear. I don't have any doubts about the RNA nor the reverse transcription and even then it's not showing up. I've probed three pairs of primers, designed with primer BLAST, here are they:

1. Fwd: TATGGTGACAAGACGCCACAT

    Rev: GCTTCTCAAAGTGCTTCTGCC

2. Fwd: GCTAATCTCATCCAGGCTGCGTG

    Rev: CTCAAACAAGAGGGCCAGCTC

3. Fwd: ATGGTGACAAGACGCCACAT

    Rev: CACGCAGCCTGGATGAGATT

GADPH Primer: 

For: GAGAAACCTGCCAAGTATGATGAC

Rev: ATCGAAGGTGGAAGAGTGGG

HPRT Primer:

For: GTTCTTTGCTGACCTGCTGGA

Rev: TCCCCCGTTGACTGATCATT