Why is DNA gyrase is not amplifying?

More Glory Bassey's questions See All

Why does using two different programs to assemble sanger forward and reverse sequences result in two different consensus sequences?

I used Geneious and codoncon Aligner programs to assemble my reads and I noticed that there was a slight difference in at least the beginning.

28 April 2023 9,765 1 View

Can crude oil kinematic viscosity measurements be extrapolated beyond the test range?

I am wondering if kinematic viscosity measurements of crude oil be numerically extrapolated to obtain accurate values for higher and lower temperatures than the test range. Has anyone done this...

16 March 2023 9,995 0 View

How to resolve "Unable to read file as the specified filetype: LANDSAT_GEOTIFF_META"?

Please I am having difficulty opening Landsat images in ENVI 5.1 using File>open as>Landsat> Geotiff with Metadata. It keeps flagging the following error message "Unable to read file as...

13 March 2023 6,700 20 View

Is there a Stanhope-Seta KV-8 Viscometer Bath?

Has anyone used Stanhope-Seta KV-8 Viscometer Bath following any standard test method for Kinematic Viscosity measurements of crude oil or any other fluid? #viscosity #viscometer #crudeoil...

07 March 2023 9,037 0 View

What are the best research topics for the student undertaking Master of Public administration?

topic and the most suitable area

27 February 2023 7,099 7 View

How to calculate amplicon size?

Hello I have blast my primers and I can't find the position of the primers. forward primer: TGGCCACCCCCTCGATGA Reverse primer: TTTAGGAGCCAGGGAGTTATA Please, is the position of the primer the same...

19 December 2022 5,455 3 View

Can someone help with GC-FID Report Analyses guidance for a non-Chemist?

How do I convert the Peak Area (pA*s) measurements in a GC-FID lab report into mass/weight percent of components for analysed crude oil samples? How do I characterise the n-paraffins and estimate...

15 December 2022 6,663 4 View

Organic Chlorides: Wax Inhibitors, Solvents, Foulants or Contaminants in Crude Oil?

How effective and widely used are organic chlorides as paraffin inhibitors in waxy petroleum fluids? If no, why not? Three patents (EP0258179A1, EP0256979A1 and US4997580A) issued in the late 80s...

05 November 2022 5,965 0 View

Apart from nasopharyngeal and dermal problems, what can overexposure to cement dust cause in the human body?

Health effects due to exposure to cement

24 October 2022 4,818 2 View

Please what novel methods can be used to assess groundwater vulnerability to pollution?

Groundwater is one of the main sources of drinking water in urban and semi-ur ban areas, thus assessment of vulnerability to delineate areas that are more susceptible to contamination is very...

26 August 2021 5,234 4 View

How to confirm the site-directed mutagenesis result without performing NGS?

I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...

08 August 2024 4,645 2 View

I can't see the ssDNA band after performing asymmetric PCR. Is there any way to do this?

After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...

08 August 2024 1,668 3 View

How much total RNA concentration to be extracted from sorted plasma cells from bone marrow of C57BL/6 mice for RT-PCR ?

i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...

05 August 2024 8,835 1 View

Why after performing site directed mutagenesis ,I don't see any colony after transformation?

I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...

05 August 2024 9,059 3 View

Anyone having idea about VN primer for miRNA primer design ?

How to design VN primer to attach with universal reverse primer

05 August 2024 2,116 3 View

Does anyone have issues using Prepman Ultra reagent for MicroSeq ID bacterial, fungal and yeast sample preparation?

I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...

01 August 2024 2,079 0 View

I'm optimizing a tetra-ARMS PCR protocol with amplicon sizes: 165bp, 123bp and 93bp. Why, in the gel, only 165bp is visible while I'm expecting all 3?

It's an end-point PCR protocol. I'm using 1.5% agarose gel with SyBR Safe dye and TBE as a running buffer, visualization on BioRad XR+ system. I was primarily thinking of primer efficiency,...

01 August 2024 4,673 4 View

PCR showing no bands - Master mix and primers didn't mix?

Hello everyone, I performed a PCR yesterday, and the results showed no bands on the gel. Of course, I probably missed some crucial steps, like adding my samples to the PCR strips themselves, for...

31 July 2024 2,406 6 View

Dimensions of an MJ Research 96-well alpha module?

Can anyone with an MJ research / BioRad PCR machine from ~2010 or earlier tell me the external measurements (LxWxH) of the removable standard PCR alpha modules that can be removed from a PTC200 or...

30 July 2024 2,867 0 View

How to retain amplicon yield after Ampure bead cleanup, following a 2-stage PCR protocol?

Hello all, I have been trying to follow a 2-stage PCR protocol used to amplify barcodes of a large yeast library, as per Nyugen et al. (2022) -...

30 July 2024 841 2 View

Katie A Burnette

It could be either or both. Do you have a set of control primers for a gene that you know is highly conserved (e.g. actin) to see if the DNA extractions worked?

Glory Bassey

I ran a PCR to amplify wsp (Wolbachia) and it amplified, that's why am concerned. I am currently trying something else and will soon see if it worked.

Akida Jahan

Which enzyme are you using? And what's the size of your gene of interest? Some enzymes are less efficient for amplifying large gene.