Why does using two different programs to assemble sanger forward and reverse sequences result in two different consensus sequences?

29 April 2023 1 10K Report

I used Geneious and codoncon Aligner programs to assemble my reads and I noticed that there was a slight difference in at least the beginning.

Katie A S Burnette

It's probably a difference in the quality cut-off by the different programs. The first ~50 bases are normally low-quality and will be trimmed off. The exact threshold varies by program.

Badges
Science topic

More Glory Basiono Bassey's questions See All

Can crude oil kinematic viscosity measurements be extrapolated beyond the test range?

I am wondering if kinematic viscosity measurements of crude oil be numerically extrapolated to obtain accurate values for higher and lower temperatures than the test range. Has anyone done this...

16 March 2023 9,995 0 View

How to resolve "Unable to read file as the specified filetype: LANDSAT_GEOTIFF_META"?

Please I am having difficulty opening Landsat images in ENVI 5.1 using File>open as>Landsat> Geotiff with Metadata. It keeps flagging the following error message "Unable to read file as...

13 March 2023 6,700 20 View

Is there a Stanhope-Seta KV-8 Viscometer Bath?

Has anyone used Stanhope-Seta KV-8 Viscometer Bath following any standard test method for Kinematic Viscosity measurements of crude oil or any other fluid? #viscosity #viscometer #crudeoil...

07 March 2023 9,037 0 View

What are the best research topics for the student undertaking Master of Public administration?

topic and the most suitable area

27 February 2023 7,099 7 View

How to calculate amplicon size?

Hello I have blast my primers and I can't find the position of the primers. forward primer: TGGCCACCCCCTCGATGA Reverse primer: TTTAGGAGCCAGGGAGTTATA Please, is the position of the primer the same...

19 December 2022 5,455 3 View

Can someone help with GC-FID Report Analyses guidance for a non-Chemist?

How do I convert the Peak Area (pA*s) measurements in a GC-FID lab report into mass/weight percent of components for analysed crude oil samples? How do I characterise the n-paraffins and estimate...

15 December 2022 6,663 4 View

Organic Chlorides: Wax Inhibitors, Solvents, Foulants or Contaminants in Crude Oil?

How effective and widely used are organic chlorides as paraffin inhibitors in waxy petroleum fluids? If no, why not? Three patents (EP0258179A1, EP0256979A1 and US4997580A) issued in the late 80s...

05 November 2022 5,965 0 View

Apart from nasopharyngeal and dermal problems, what can overexposure to cement dust cause in the human body?

Health effects due to exposure to cement

24 October 2022 4,818 2 View

Why is DNA gyrase is not amplifying?

I am trying to amplify gyrB from Cardinium. I have tried conventional and nested PCR and only some samples amplify, is it because of the primers or the is it the sample?

06 April 2022 1,392 3 View

Please what novel methods can be used to assess groundwater vulnerability to pollution?

Groundwater is one of the main sources of drinking water in urban and semi-ur ban areas, thus assessment of vulnerability to delineate areas that are more susceptible to contamination is very...

26 August 2021 5,234 4 View

Can I base on reverse DNA sequences to perform alignment, convert to amino acids and GenBank submission?

I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?

11 August 2024 5,138 1 View

How to confirm the site-directed mutagenesis result without performing NGS?

I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...

08 August 2024 4,645 2 View

Why did the authors extrapolate a phenotype that they experimentally proved in one bacterial strain across the whole genus of the organism?

I aim to be as skeptical as possible regarding whether a pair of orthologous genes results in the same phenotype in their different but related bacterial organisms under similar environmental...

05 August 2024 6,787 4 View

Does anyone have issues using Prepman Ultra reagent for MicroSeq ID bacterial, fungal and yeast sample preparation?

I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...

01 August 2024 2,079 0 View

How is the bacterial genome's high protein count verified as genuine despite 800+ contigs and good metrics (98.55%completeness, 0.68% contamination)?

Given that the bacterial genome has over 800 contigs, but its quality metrics are good, with a completeness of 98.55% and a contamination of 0.68% as assessed by CheckM, what specific validation...

01 August 2024 1,514 1 View

Should the amount of DNA input used for ChIP-seq library preparation be matched between the control and experimental groups?

Hi all. As a beginner in ChIP-seq experiments, I hope you understand that the following questions might be somewhat basic. I am planning to perform ChIP-seq or MeDIP-seq analysis to investigate...

28 July 2024 6,938 1 View

If my gene of interest has high GC content can it be problematic in sequencing? What kind of error is expected with GC rich gene sequences??

Gene sequencing related trouble shooting

25 July 2024 4,149 2 View

Does post-translational protein modification cause devisions on observed pI verses calculated pI?

In running two-dimensional gel electrophoresis on bacterial protein, some spots that appear to match a protein sequence have a significantly more acidic isoelectric point than the calculated pI....

24 July 2024 8,076 3 View

Are there always been barcodes, apapters and primer sequences in the FASTQ files of NGS?

Hello researchers, Sorry for my stupid question. I am learning the QIIME2 workflow for analyzing some 16s amplicon NGS fastq data. I found a very nice paper with data and code public available...

20 July 2024 5,405 2 View

How do you assign allele numbers and sequence type after amplifying housekeeping genes by PCR for MLST?

How to assign allele numbers and sequence type after amplifying housekeeping genes by PCR for genotyping of S. pneumoniae strains by MLST using bioedit ?

19 July 2024 5,239 2 View