Hi,
I am trying to amplify 190bp a gene promoter from bacteria genomic DNA using following specific primers :[FP: 5’GATCGAATTCGGTAACATTTGTGCCCATAG3’; Tm 59.6] and [RP: 5’CTGAGACGTCGCTTTCGCAGATTCATTGTG3’;Tm 60.9] using Taq polymerase using following conditions:95C-1 min; 95C-30sec, 55-65C-30 seconds,72C-30seconds and 72C-7 mins]*30 cycles(10X Taq buffer-5 ul, FP-1 ul, RP-1 ul, dNTPs-ul,DMSO-2.5ul, DNA-1ul,Taq polymerase -0.5ul) for 50 ul volume.I am not getting a specific band instead getting a smear even after gradient PCR. What could be the problem regarding this? I am attaching photo of my gel.
… Read more
Answer this question