Geetika Sharma

3 Questions 1 Answers 0 Followers

Questions related from Geetika Sharma

How to submit gene sequence with gaps to NCBI?

Hi, I have amplified a partial gene sequence of a bacteria with the help of degenerate primers and want to submit it to NCBI, but when I am doing CDS analysis in BLAST getting 74% similarity and...

26 February 2022 3,465 3 View

Why am I getting smear after PCR ?

Hi, I am trying to amplify 190bp a gene promoter from bacteria genomic DNA using following specific primers :[FP: 5’GATCGAATTCGGTAACATTTGTGCCCATAG3’; Tm 59.6] and [RP:...

08 February 2022 3,406 4 View

Which matrix is best suited for constructing Maximum Likelihood tree WAG or JTT?

I want to construct a Maximum likelihood tree of gene sequence from isolated species and a full-length sequence of the same gene in other species obtained from Genbank, but I am unable to decide...

26 February 2021 2,495 1 View