3 Questions 1 Answers 0 Followers
Questions related from Geetika Sharma
Hi, I have amplified a partial gene sequence of a bacteria with the help of degenerate primers and want to submit it to NCBI, but when I am doing CDS analysis in BLAST getting 74% similarity and...
26 February 2022 3,477 3 View
Hi, I am trying to amplify 190bp a gene promoter from bacteria genomic DNA using following specific primers :[FP: 5’GATCGAATTCGGTAACATTTGTGCCCATAG3’; Tm 59.6] and [RP:...
08 February 2022 3,416 4 View
I want to construct a Maximum likelihood tree of gene sequence from isolated species and a full-length sequence of the same gene in other species obtained from Genbank, but I am unable to decide...
26 February 2021 2,509 1 View