I want to isolate fungal DNA from culture plate (from mycelium). Which kit is suitable for this? Which primers should i use for downstrean processing , e.g., PCR and sequencing for phylogenetic study?
Hi,
I recommend you Qiagen DNeasy Plant Mini Kit for fungal DNA isolation from the mycelium. This kit works perfectly for fungi and plants.
You can use the universal primer pair ITS1/ITS4 for PCR and sequencing. This primer pair is commonly used for fungal phylogenetic analysis.
ITS1: TCCGTAGGTGAACCTGCGG
ITS4: TCCTCCGCTTATTGATATGC
Best wishes,
Tuan Tran
I agree with Tuan, we've had the best success with using the plant kit from Qiagen for DNA extraction from our filamentous fungi. We do achieve higher yields by adding a couple free thaw cycles as well as extending the incubation period to 65C overnight with shaking. Those modifications may or may not be required but are options that you can try to improve results with your particular fungus.
Regards
Barry
You can even use some soil kits if you have spare. I've used the PowerSoil of MoBIO before.
The ITS is good for barcoding in most situations but it is not stable enough to be very phylogenetically informative. I'd do the LSU too.
You can check the paper linked below to get an idea.
Article Fodinomyces uranophilus gen. nov. sp. nov. and Coniochaeta f...
- Badges
- Science topic
- Similar topics
- Biological Science
- Biota
- Eukaryota
- Fungi