Hi Aziz, I insert gRNA sequence into CRISPR constructs similar to what you are using regularly and it worked at greater than 90% efficiency so far. What I did a little differently for my oligo  cloning is to do the kinasing first of the single strands at 37C for 30mins or so using https://www.neb.com/products/m0201-t4-polynucleotide-kinase#Product%20Information_Properties%20and%20Usage

and then combine the oligo pair to generate the double stranded DNA at 70C with gradual temp decrease in water bath.

By the way, while thinking about your situation, I also thought that oligo annealing can have issues depending on your oligo sequence.  If you have palindromes in the sequence, that may prevent it from working properly. Just a thought.

Hi Andika Gunadi, thanks for your suggestions. I followed your advice but still did not not get colonies on the second day using our lab made chemically competent cells. But I left the plates in incubator and today after two days, almost 36 hours, I saw many. I am not sure if it is DH5 alpha or not as DH5 apha normally does not take that long.

As far as sequences are conserved, I have checked them many times and I don't see any problem. I am pasting them below. You can also have a look. The bold bases are complementary to vector after BsaI cut. Both ends of the vector,  with BsaI sites are also attached here..

 1.

GGCAGAGTTGTCTGAATCTGGCTG

AAACCAGCCAGATTCAGACAACTC

2.

GGCACCGCGCAGAAGGCGCTCCGC

AAACGCGGAGCGCCTTCTGCGCGG

3.

GGCACCTGGTTCCAAGAAATGGCT

AAACAGCCATTTCTTGGAACCAGG

3.

GGCATCATCAATCAAGAAGTGCAA

AAACTTGCACTTCTTGATTGATGA

4.

GGCATGAAGCAAAGGCAGACAAGG

AAACCCTTGTCTGCCTTTGCTTCA

5.

GGCAGGGGTCCTACAGCTGCAAGG

AAACCCTTGCAGCTGTAGGACCCC

Hi Aziz,

getting a lot of colonies after 2 days would likely be from the antibiotics breaking down. 

What ligase and ligation protocol did you follow? That is a key step as well and may likely be the cause of your problem, not the gRNA sequences, which to me look fine.

we use T4 ligase in my lab from Promega, and I use 1:2 molar ratio of vector backbone to insert paired oligo. I incubate the ligation mixture for about 24 hours in 4C before transforming into dh5a.

Thanks Andika Gunadi,

We are using two different T4 Ligases, one from Thermo Fisher Scinetific, the other from NEB,

https://www.thermofisher.com/order/catalog/product/15224041

https://www.neb.com/protocols/1/01/01/dna-ligation-with-t4-dna-ligase-m0202

The same are used by other lab mates and also me for other clonings, that work fine. 

The initial protocol was  like, {9ul insert ( which i get by mixing 10ul of each 100uM oligo, heat at 99C or 95C for 5 mins and cool slowly at RT for 45 mins, also tried hot water at 70C), 3ul gel purified vector, 2ul T4 buffer, 2ul T4 ligase, total volume 20ul}, incubate at room temperature for 2 to 8 hours, then use 3,4,5ul for transformation. 

Later on, I added the phosphorylation step using PNK, mixed 1ul of each of the two 100uM oligos, 5ul T4 ligase buffer, 1ul PNK, total volume 50 ul. Incubated at 37C for 1 hour, then added 2.5ul IM NaCl, heated at 99C or 95C for 5 mins and cooled slowly. Then diluted 10 times and used 2ul of the diluted oligos for ligation as {2ul oligos, 1 ul vector, 2ul ligase buffer, 1 ul ligase, 14ul dd water}, the rest of the procedure is as above. 

I also tried as you suggested, treated one of the two oligos with PNK but that too did not work. 

After all this I have doubt on our competent cells (but I am not sure), I think our construct is too large, around 13kb and our poor competent cells are unable to pick it up. By the way, the positive control works (which I use the vector only). 

Hi Aziz, 

I performed similar experiments as you. I don't see any problem in your protocol, and I used a similar one to introduce sgRNA sequences in my vector. 

I already transfected DH5 alpha cells with 10kb vectors. I didn't try with 13kb, but if your positive control works that may not be the problem. 

If I were you, if nothing else works, I would check if the restriction of the vector worked, by running on a gel and/or by sequencing the cutting sites. There could always be an off chance your enzyme doesn't work anymore or that you had a very unfortunate mutation at the cutting sites/sticky ends. 

Good luck!

Dear Flore Castellan,

Thanks for your time. My problem got solved by simply changing the competent cells which I was always doubtful about. Your suggestion is of course useful in case cloning fails after trying all the strategies. 

@Aziz Hi. Which competent cell strain worked for you? I am having similar problem like you had faced.

Sarbesh Das Dangol , I used lab developed highly competent DH5α cells and they worked for me.