Hello everyone,
Vaccinia virus (VV) p7.5 promoter is a widely use promoter for engeering the expression of exogenous protein . The p7.5 promoter (TAAAAGTAGAAAATATATTCTAATTTATTGCAC) locates at 190235-190267 position in the VV genome (NC_006998.1). It is supposed to control a 7.5 K protein, but there is few publications on this protein. I can only find a record (GenBank id: P68628.1) named as "Full=Uncharacterized 7.5 kDa protein", which might be the 7.5 K protein controled by the p7.5 promoter. However, the location of the encoding gene for this protein is 190855-190652 (5' to 3'). This means that the 7.5 K protein locates at the upstream of the promoter, and it has a opposite direction with the p7.5 promoter. I think the promoter and the gene it regulates should have the same direction, doesn't it? How would you explain the positional and directional relations between the 7.5 K protein and the p7.5 promoter?
Thank you in advance!
- Badges
- Science topic
- Similar topics
- Biological Science
- Microbiology
- Virology
- Virus