Arthur Tang

4 Questions 4 Answers 0 Followers

Questions related from Arthur Tang

Why does recombinant MVA not obviously replicate in the presence of agarose overlay?

Dear all, I am trying to isolate recombinant Modified Vaccinia Ankara (MVA) clones from plaques in the presence of an agarose overlay. I transfected the MVA-infected DF-1 cells with a shuttle...

04 August 2023 3,488 0 View

What should be the length of spacer between the promoter and ORF?

Dear all, I am trying to construct a plasmid vector that contains a vaccinia virus protomer (p7.5, p11, etc.) and a marker gene (GFP, mcherry, etc.). I can find the sequences of the promoter. For...

18 January 2023 8,145 5 View

What is the relation between vaccinia vaccinia p7.5k promoter and the 7.5k protein?

Hello everyone, Vaccinia virus (VV) p7.5 promoter is a widely use promoter for engeering the expression of exogenous protein . The p7.5 promoter (TAAAAGTAGAAAATATATTCTAATTTATTGCAC) locates at...

01 January 1970 6,025 0 View

Why do transformed Top10 cells can grow in LB medium but not on LB Agar plates?

Hello everyone, I have Top10 cells transformed with an ampicillin-resistant plasmid. I find that these cells can grow in LB medium but not on LB Agar plates with 50 ug/mL ampicillin. Do you know...

01 January 1970 3,225 2 View