4 Questions 4 Answers 0 Followers
Questions related from Arthur Tang
Dear all, I am trying to isolate recombinant Modified Vaccinia Ankara (MVA) clones from plaques in the presence of an agarose overlay. I transfected the MVA-infected DF-1 cells with a shuttle...
04 August 2023 3,572 0 View
Dear all, I am trying to construct a plasmid vector that contains a vaccinia virus protomer (p7.5, p11, etc.) and a marker gene (GFP, mcherry, etc.). I can find the sequences of the promoter. For...
18 January 2023 8,216 5 View
Hello everyone, Vaccinia virus (VV) p7.5 promoter is a widely use promoter for engeering the expression of exogenous protein . The p7.5 promoter (TAAAAGTAGAAAATATATTCTAATTTATTGCAC) locates at...
01 January 1970 6,071 0 View
Hello everyone, I have Top10 cells transformed with an ampicillin-resistant plasmid. I find that these cells can grow in LB medium but not on LB Agar plates with 50 ug/mL ampicillin. Do you know...
01 January 1970 3,277 2 View