Hello every one
I'm working on micRNA expression and need the SNORD44 for normalization ,
please i need the sequences of SNORD44 primer because i cant find it in the published papers .
best regards
Assuming you are using stem-loop cDNA approach, the gold standard for miRNA qPCR. For the SNORD44 sequence at NR_002750.2 (NCBI),
1. Append "5' AGTCAG 3'" to the 3' end of your base stem-loop primer.
2. Pick forward primer below to match your universal reverse primer.
Forwards 5' to 3';
Seq Tm
CCTGGATGATGATAAGCAAATGCT 55
CCTGGATGATGATAAGCAAATGCTG 56
CCTGGATGATGATAAGCAAATGCTGA 57
CCTGGATGATGATAAGCAAATGCTGAC 58
CCTGGATGATGATAAGCAAATGCTGACT 59
CCTGGATGATGATAAGCAAATGCTGACTG 60
CCTGGATGATGATAAGCAAATGCTGACTGA 60
These are derived using my R helper tool at https://github.com/caanene1/miRNAprimer
You can also configure the source to match your need.
Hello researchers I have a fresh oral tissue samples collected by Rovers Orcellex Brush , unfortunately I can not use any kit. Please, I need trusted protocol to extract DNA from this brush...
10 November 2019 8,485 3 View
Hello everyone I'm working on haplotypes case control association study, for data analysis , I employed two online analysis softwares , The first is (SNPstats) which gave me extremely large odd...
11 December 2018 1,515 1 View
Hello researchers all of us know, that we need a special protocol to extract DNA from frozen blood other than protocol which used to extract DNA from fresh blood . the question is : .what are...
08 September 2018 480 5 View
Hello researchers Can somebody please , provide me the recipes to prepare buffers that used with silica spin column and the protocol to isolate the genomic DNA from blood . best regards
02 March 2018 1,327 4 View
Hello researchers . one of my colleagues develops a new drug and he think that this drug inhibit the activity of RNA polymerase II (transcription ) . the question is , how to estimate this...
01 February 2018 7,732 2 View
Hello researches I'm planning to sequence about 800 bp region of a certain gene to assess its association with a certain disease. the question is , do i have to choose an intronc or exonic...
31 December 2017 3,511 5 View
Hello researchersthere are several reasons to observe a negative peak in HPLC/UV chromatogram , but can this negative peak be due to the presence of fluorescent material. best regards ....
08 September 2017 6,657 4 View
Hello researchers the annealing temperature gradient is the routine step in PCR optimization , but why we do not use annealing time for optimization? regards .
07 August 2017 6,134 15 View
Hello researchers i'm aiming for sequencing 880 nt RNA segment. can i use the ordinary Taq-PCR master mix or i have to use the high fidelity master mix .thank for any suggestions.
06 July 2017 3,910 9 View
Hello researchers I just want to know what happen to the proteins molecules after they migrated out of the gel ( in SDS-PAGE) , of course the simple answer says that the protein migrated to the...
11 December 2016 5,996 11 View
I would like to learn more about SPSS and Its application especially in regards to data analysis. Please suggest me how I can learn more about it. Thank you so much.
11 August 2024 9,101 4 View
Hello, I am currently having problems with RNA extraction. I am using mouse liver (C57BL6J), and I have extracted RNA from mouse liver before. Before this experiment, my final RNA pellets were...
11 August 2024 7,082 3 View
I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?
11 August 2024 5,138 1 View
Hello, Why do i see this baseline drift when i compare my blank (black) to the sample (blue)? Any suggestions as to why this happened? Thank you!
11 August 2024 3,770 4 View
Willett, Shenoy et al. (2021) have developed a brain computer interface (BCI) that used neural signal collected from the hand area of the motor cortex (area M1) of a paralyzed patient. The...
10 August 2024 7,180 0 View
I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...
10 August 2024 7,429 2 View
I have been doing the m6A dot blot for a while with no improvement, I am extracting the RNA, and I can see the dots although the three biological replicas give a different reading on the memberan...
10 August 2024 8,539 5 View
How can I use the cif data obtained from rietveld refinement extracted via gsas2, for microstructural analysis using ETEX software?
09 August 2024 7,718 0 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
I've been performing RNA extraction on cotton petiole tissue for a few months now using the method described in the following paper, a derivative of the typical hot borate method...
08 August 2024 9,882 2 View