Hello every one
I'm working on micRNA expression and need the SNORD44 for normalization ,
please i need the sequences of SNORD44 primer because i cant find it in the published papers .
best regards
Assuming you are using stem-loop cDNA approach, the gold standard for miRNA qPCR. For the SNORD44 sequence at NR_002750.2 (NCBI),
1. Append "5' AGTCAG 3'" to the 3' end of your base stem-loop primer.
2. Pick forward primer below to match your universal reverse primer.
Forwards 5' to 3';
Seq Tm
CCTGGATGATGATAAGCAAATGCT 55
CCTGGATGATGATAAGCAAATGCTG 56
CCTGGATGATGATAAGCAAATGCTGA 57
CCTGGATGATGATAAGCAAATGCTGAC 58
CCTGGATGATGATAAGCAAATGCTGACT 59
CCTGGATGATGATAAGCAAATGCTGACTG 60
CCTGGATGATGATAAGCAAATGCTGACTGA 60
These are derived using my R helper tool at https://github.com/caanene1/miRNAprimer
You can also configure the source to match your need.
Hello researchers I have a fresh oral tissue samples collected by Rovers Orcellex Brush , unfortunately I can not use any kit. Please, I need trusted protocol to extract DNA from this brush...
10 November 2019 8,270 3 View
Hello everyone I'm working on haplotypes case control association study, for data analysis , I employed two online analysis softwares , The first is (SNPstats) which gave me extremely large odd...
11 December 2018 1,308 1 View
Hello researchers all of us know, that we need a special protocol to extract DNA from frozen blood other than protocol which used to extract DNA from fresh blood . the question is : .what are...
08 September 2018 311 5 View
Hello researchers Can somebody please , provide me the recipes to prepare buffers that used with silica spin column and the protocol to isolate the genomic DNA from blood . best regards
02 March 2018 1,065 4 View
Hello researchers . one of my colleagues develops a new drug and he think that this drug inhibit the activity of RNA polymerase II (transcription ) . the question is , how to estimate this...
01 February 2018 7,574 2 View
Hello researches I'm planning to sequence about 800 bp region of a certain gene to assess its association with a certain disease. the question is , do i have to choose an intronc or exonic...
31 December 2017 3,300 5 View
Hello researchersthere are several reasons to observe a negative peak in HPLC/UV chromatogram , but can this negative peak be due to the presence of fluorescent material. best regards ....
08 September 2017 6,391 4 View
Hello researchers the annealing temperature gradient is the routine step in PCR optimization , but why we do not use annealing time for optimization? regards .
07 August 2017 5,874 15 View
06 July 2017 3,748 9 View
Hello researchers I just want to know what happen to the proteins molecules after they migrated out of the gel ( in SDS-PAGE) , of course the simple answer says that the protein migrated to the...
11 December 2016 5,839 11 View
Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...
03 March 2021 8,796 3 View
I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance
03 March 2021 3,568 1 View
Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...
03 March 2021 5,978 5 View
Results of single-case research designs (i.e., n-of-1 trials) are often evaluated by visually inspecting the time-series graph and computing quantitative indices. A question our research team is...
03 March 2021 687 1 View
What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...
03 March 2021 1,401 3 View
I have conducted and published a systematic review and meta-analysis research with the topic related to public health and health pomotion (protocol was registed in PROSPERO). Now we want to...
03 March 2021 8,920 3 View
dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...
03 March 2021 6,994 5 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
I just wanted to check if I need to run a linear regression separately if I am using PROCESS MACRO to run mediation analysis. Thank you.
02 March 2021 4,359 3 View