I am viewing VCF data in IGV and a few listed mutation have an allele frequency of -1. I have never seen a negative allele frequency before. What is the meaning of this?

The mutation itself is slightly confusing. The reference sequence is TTCACTCCAATGCTGC , but the listed mutation says that there is an insertion causing the 3rd T to become TCCAATGCTG. This insertion sequence matches exactly to what the reference sequence already is. Does that mean that the sequence could be repeated, making the mutated sequence: TTCACTCCAATGCTGCCAATGCTGC .

Thank you for any help you can provide!