I have a minigene library which is amplified with P5/P7 sites that looks like this
[P7/barcode][constant region][ variable region ][18nt constant region][SP1][P5] (436nt total)
We sequenced this library using the standard Illumina read 1 primers @ low cluster density (~600k) + 25% PhiX. Unfortunately, only a small fraction of clusters passed filter because of the low sequence diversity. Before we redesign the library, we are considering using a custom primer to sequence over the constant region:
5' ACGCTCTTCCGATCTTTGGCCTGTTTGGCCTTA 3'
This custom primer is 33nt, 52% GC, Tm ~ 66ºC. It binds to the complete constant region along with half of SP1. The first nucleotide after the primer is the first base of the variable region. It will be tested by PCR to make sure it amplifies from the amplicon.
Before we use it for sequencing, I wanted to know if anyone had any experience sequencing with a custom primer that does not immediately abut the P5 hybridization site. I assume this should be OK, but wanted to get other people's opinion on this and any other issue I should consider first. For instance, are there any modifications that should be included when ordering this primer (other than HPLC purification).
Better use an Ion Torrent platform next time, this platform has no problems with low complexity samples.
- Badges
- Science method