Hi ,
I am new with the Illumina sequencing and I got back the sequencing data. I am quite new with the terminology. Can you explain to me what it means that a project will be sequenced using "2x250bp paired-end reads"? To what do the numbers refer? Also, I am asked to provide information on my annual report about:
insert size
quality control
how the genomes were assembled
how the genomes were annotated
but I have no idea of where to get this information. Is an information that the company provides?I can't find it anywhere on the company website (MicrobesNG)..
Thank you very much in advance.
Silvia
Hi Silvia,
Next generation sequencing platforms make use of two types of technologies. Single-end and paired end sequencing.
Paired end sequencing refers to the fact that the fragment(s) sequenced were sequenced from both ends and not just the one (as was true for first generation sequencing). These fragments are prepared in 'libraries', which are fragmented DNA and which are size selected to about 600-900 bp. This is referred to as the library size.
The insert size is the library size minus your two read pairs' sizes. This area that is not sequenced between the read pairs.
Quality control, assembly and annotation is steps which you are to perform by yourself. These steps will greatly depend on the application of the techniques as well as the aims you have for the project. The scope of which is too wide to answer here.
Hope this helps.
Andries
Hi Silvia,
Next generation sequencing platforms make use of two types of technologies. Single-end and paired end sequencing.
Paired end sequencing refers to the fact that the fragment(s) sequenced were sequenced from both ends and not just the one (as was true for first generation sequencing). These fragments are prepared in 'libraries', which are fragmented DNA and which are size selected to about 600-900 bp. This is referred to as the library size.
The insert size is the library size minus your two read pairs' sizes. This area that is not sequenced between the read pairs.
Quality control, assembly and annotation is steps which you are to perform by yourself. These steps will greatly depend on the application of the techniques as well as the aims you have for the project. The scope of which is too wide to answer here.
Hope this helps.
Andries
Hi.
You can watch this video: https://www.youtube.com/embed/ZcxmlSbn19Q?iframe&rel=0&autoplay=1
Hi All,
I had several further questions about paired end sequencing. Say I have a 600bp fragment, if it is sequenced from both end with 250bp, the 100bp in the middle will be left out without sequencing, is that correct? Then we compare the sequence to the reference genome, in this case, insertions and deletions can be found, however, if there are any mutations in the 100bp unsequenced region, there is no way to know, is that correct? Mutations can only be found from the sequenced two ends?
Thanks,
Jing
Hi Jing,
The answer is yes to the three questions.
But consider that in the sequencing of a genome, a multitude of paired end sequences are generated. Look at the following example with "Courier" font:
Reference : ACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAA
Paired_end_1: ....CAGTTGACAC----------ACGAAAGTGG................
Paired_end_2: ........TGACACAAAA----------AAGTGGCGTT............
Paired_end_3: .CTCCAGTGGA----------ACTACGAAAG...................
Paired_end_4: ..............AAAATAGACT----------CGTTAACATA......
Paired_end_5: ..........ACACAAAATA----------GTGGCGTTAA..........
Genome__seq : .CTCCAGTTGACACAAAATAGACTACGAAAGTGGCGTTAACATA......
12345678901234567890123456789012345678901234567890
1 2 3 4 5
The reference genome is in the first line. You have five paired end sequences or reads. In the last line you have the genome sequenced (Genome). There is a mutation in position 36 and a read error in the read "Paired_end_3" in position 9.
Hi Vicente,
Thanks for your answer and the example!
But I got one more question here, why is that not all the paired end sequences start from the first position from 5' end and 3' end? I was thinking the fragment being sequenced should have adapter at both ends, so any reads should start from the first position at the two ends of the fragment.
Jing
Jim, it's true what you're saying.
My example is for whole genome sequencing (NGS).
Vicente.
Hi Silvia,
I think that the sequence of 2x250 bp came from miseq sequencing of V3-V4 region using 341F and 805R primers (or so), and it means that the insert is about 450 bp and about 430 bp without primers.
Thanks for above all to give your valuable feedback for the above question and i have my question is what are the validation methods available for NGS sequencing...let me ..know...
Hi,
I know this is very old question. However I am replying just to make my point and make the answer clear
In the Answer, it is mentioned that "The insert size is the library size minus your two read pairs' sizes. This area that is not sequenced between the read pairs."
I am afraid that this is not correct. The area which is not sequenced between the pairs is known as inner sequence or distance. So basically the insert size is library size minus adapter size. In general, insert size will always be more than the sum of two read lengths.
Regards,
Amit
Ji-Hoon Lee
To my knowledge, MiSeq is 2*300 bp (paired-end sequencing).
- Badges
- Science method
- Similar topics
- Biological Science
- Genetics
- Genetic Analysis
- genetic techniques
- Sequencing