Hi everyone,

I recently ran a test with our new, shorter primers for DNA barcoding, but the results have been unexpected. Below is a summary of the experimental setup and observations:

Primers Tested:

• Reverse (MF1r_bc3003): GGTAGATAGTCAGAATATGCTTTCCCACGAATAAATAATA
• Forward (bc1002): GGTAGACACACAGACTGTGAGRKTCAACMAATCATAAAGATATTGG

Additionally, I included a set using LepF_MH-R1 for comparison.

PCR Conditions:

• Techniques: Gradient PCR and Touchdown PCR
• Master Mix: Platinum Hot Start II Master Mix (Invitrogen)
• DMSO Concentrations: 0%, 2%, 4%, and 6%
• MgCl₂ Concentration: 3 mM
• Primer Concentrations: Tested at both 0.2 mM and 0.5 mM
• Cycling Parameters: Initial denaturation: 95°C for 5 minutes Denaturation: 95°C for 30 seconds Annealing: 52°C for 30 seconds Extension: 72°C for 45 seconds Final extension: 72°C for 5 minutes Total cycles: 35 or 40

Gel Observations:

• In one lane, the PCR appears negative, with only a primer dimer visible.
• In another lane—set up specifically for testing with the shorter primers—I observed successful amplification.

Has anyone encountered similar issues or have insights on what might be causing these discrepancies? I’d appreciate any troubleshooting tips or suggestions, whether they involve adjusting the PCR conditions, re-evaluating the primer design, or other factors.

Thanks in advance for your help!

DNA extracted from insects