I have sequence data from the ezRAD method. Most of the sequences have the cut site "GATC" at the start, however some do not (see example below). I am trying to find a program that will remove any sequence that does not have the "GATC" at the start. However, all I can find are trimming/adapter removal programs.
Suggestions? Was going to write my own script to do this, but would rather not re-invent the wheel.
KEEP:
@D3NT6Q1:329:C6396ACXX:6:1101:11990:3865 2:N:0:GTCCGCTCTTT
GATCTTTCTCCAATTCCCCGCTCTCCAAGTCTCAGGAGTATTCAAAACAAACAACGTCCTATTTATGCCCTGACATCACATCTCTATGGCAACCACACTT
+
BBBFFFFFFFFFFIIIIIIIIIIIIIIIIFIIIIIIIIBFFIIIIIIIIIFIIIIIFFIFIIFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFBFBFBB
DISCARD:
@D3NT6Q1:329:C6396ACXX:6:1101:2011:28589 2:N:0:GTCCGCTCTTT
TACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGGGC
+
BBBFFFFFFFFFFIIFIIIIIIIIIIIIIIIIIIIIFFFFFFFFFBFBBBBBBBBBBBBFFBFFFBFF7BBFB
@Tobias: THANK YOU SO MUCH! This works a treat. I have edited slightly to deal with files that have already been unzipped.
I am also going to post your code with comments here for anyone in the future who might need it and wants to know how it works. My bash scripting isn't the best, so please let me know if I have made any mistakes.
# Read the FASTQ, then pipe
cat initial.fq |
# grep prints lines that match a pattern
# -P reads as Perl regular expression
# The pattern:
# ^ specifies to search for "GATC" at start of line
# [ ] specifies that any of the encompassed characters can be in specified position
# * specifies that we want to search for pattern-matching lines multiple times
# $ specifies to search for "GATC" at end of line
# -B print x number of lines before the context
# -A print x number of lines after the context
# Pipe to next command
grep -P "^GATC[ACGTNacgtn]*$" -B 1 -A 2 |
# Each set of four lines is separated by an additional line containing "--"
# This needs to be removed to follow the FASTQ format
# grep to read lines
# -v inverts matching, selects non-matching
# -P reads as Perl regular expression
# The pattern:
# ^ specifies to search for "--" at start of line
# \ escape speacial meaning of "-"
# $ specifies to search for "--" at end of line
# Write the output to a new file
grep -v -P "^\-\-$" > filter.fq
- Badges
- Science method