I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification Kit and B2 binding buffer, to my surprise when i ran them on the gel i saw a smear with a stong band at 400bp, can anyone help me with how do i get rid of the smear, (most probably its denatured DNA as the sample i'm using was in -30 for almost 20 years)
It's a smear. Start doing the PCR with high quality DNA having everything freshly prepared.
it may be due to the over vortexing or vigorous pipetting. this Smear represents the degraded product
Please run a gel with all the samples together along with a marker for us to provide a better explanation. By samples, I meant, PCR product before and after purification.
1- The smear doesn't seem to be related to denatured DNA. It might be degraded DNA though I don't think that, as then the PCR would have failed. To rule out DNA degradation, it is better to run the DNA (approx. 200 ng) also in the gel.
2- What is your sample DNA? Did you see the band of your sample DNA in the PCR product also? Seems like there is some DNAse contamination during the PCR purification step that might be degrading the DNA and causing a smear.
3- As Ali Muntazir Naqvi suggested too much vortexing might lead to this. Probably there was too much template DNA in the PCR reaction and lots of vortexing and pipetting might have sheared the DNA during the purification step
Your DNA may be degraded. So, here are some tips I hope will help you:
This happens when DNA purification is inefficient and residual nuclease remains. So, check your buffers, specifically the elution buffer in the final step as it might have nuclease.
Use fresh TBE/ TAE buffer in agarose gel. To be sure in this case, you can run purified PCR product and unpurified PCR product (as a control).
As high-quality DNA is a prerequisite to performing PCR, if possible, perform PCR with new high-quality DNA.
Rizwan Khan < most probably its denatured DNA as the sample i'm using was in -30 for almost 20 years >
The DNA might have degraded after 20 years. Besides, it might had been freeze-and-thawed for many times by previous users. Take 1-2 uL out and run on a gel, to see if there is still a main band. Otherwise, you might need to isolate new DNA for PCR.
DNA (especially plasmid DNA) in Tris or TE buffer can be kept at -30 degrees for prolonged than 20 years periods. Genomic DNA may undergo degradation, when frozen and thawed.
What template DNA did you use for PCR? In optimal conditions, only tiny amounts of template should be seen on agarose gel.
I personally think that smear is originated from PCR reaction itself. It happens when template is the PCR fragment, when stringency is low (thus elevate the annealing temperature), when the polymerization step is longer than you actually need, and when using regular (e.g. cheap) Taq polymerase.
I suggest the following:
1. Run your template in gel and check its concentration by NanoDrop.
2. Do not use more than 10 ng of plasmid DNA, 1 ng of DNA fragment or 100 ng of genomic DNA or cDNA for PCR.
3. Use annealing temperature at 3-5 degrees more than the Tm of your primers.
4. Use the following enzymes: NEB Q5® High-Fidelity DNA Polymerase or Thermo Platinum SuperFi II DNA Polymerase. Both at 60 degrees of annealing. I use mixes of these enzymes.
5. If 400 bp band is a right band, just cut it off the agarose gel and proceed with the band.
Great success,
Yevgeny
- Badges
- Science method