Hi Shalini,

Do you already have a source for the septin7 ORF and the final receptor plasmid you want? Do you need help with the cloning or to obtain the ORF of the Septin7.

I have to start it from the scratch. I dont have any source for Sept7.

Do you have the reaqents required for RNA isolation, PCR, a reverse transcriptase to generate a cDNA library, intermediate cloning vectors for fast cloning of the PCR products (to save the template) the final vector you want and restriction enzymes? Restriction enzymes aren't essential ligation independent don't protocols can be used.

It would help to know what you have  available in your lab for molecular biology in order to guide you.

First check in pubmed for the entry number of the Septin7 you need. 

I guess is this one:

Mus musculus septin 7 (Sept7), transcript variant 1, mRNA

NCBI Reference Sequence: NM_009859.4

Double check

we have all the reagents available in the lab. I need the steps to design the plasmid for Sept 7. I have no clue what steps should be followed to designed the plasmid . as this particular plasmid is not available in the market so I have to design it.

the link which u have sent is the correct one.

First you should get the Septin7 cDNA. I would recomend to ask around in your institution whether somebody have, and would be willing to spare, few microliters of a murine cDNA library. If you find some one, then getting primers to PCR out the Septin7 ORF is the next step. Otherwise you'll have to purify RNA from murine samples and prepare a cDNA library yourself. Don't freak out, this is very simple.

For generating the primers I like to use the NCBI tool: http://www.ncbi.nlm.nih.gov/tools/primer-blast.

In general I'd like to generate on pair of primers sitting in the 5' and 3' UTR for the first amplification and to clon this PCR product in a cloning vector fast an efficient so you can save the template for future applications (I use pJet1.2 from fermentas). Once you have the cloned ORF to work you can start designing the cloning that better suits your porpouses.

I run the sequence to get the primers and the pair I would use is the following:

Sequence (5'->3')

Forward primer TCGCGGAGGGGGAGG [(15 bp) it matches 184-198 from the sequence with a Tm of 59.63ºC].

Reverse primer AACACTGATGTCCAAGCTGGC [(21 bp) it matches 1573-1553 from the sequence with a Tm of 61.16 ºC].

Product length 1390