Dear all:
I replace the sp6 promoter sequence (ATTTAGGTGACACTATAG) by T7 (TAATACGACTCACTATAGGG), after I transfected IVT mRNA into 293T cells, very fewer EGFP positive cells in T7 IVT mRNA transfected cells. Because of the sequence?
Thanks!
The phage promoter should not have an effect on translation in mammalian cells. I'm guessing one of the transfections must have gone randomly wrong. Was it the same batch of cells, on the same day, same protocol? Sometimes these can be hard to reproduce exactly. Did you measure the RNA concentration for each, and did you transfect the same amount?
Thanks, according to the gel, similar quantity and quality. Transfected to the same plate in different wells. Just the different ivt kit, one for sp 6 one for t7 from thermo.
- Badges
- Science method