To answer your question, you would need to provide more information about the gene in question, such as the positions of the introns and exons within the gene and the specific DNA sequence of the splice sites. Additionally, counting transitions between introns, exons, and splice sites is not a meaningful or informative way to analyse a DNA sequence.

Hi Suvarna

in addition to Samiullah Khan answer, you could give the species of your samples and how you obtained this sequence. since 30bp is very small in regards to genes length, chance to get inions and introns are very thick, null in reality.

give more details, you should receive more help

all the best

fred

sure sir, @frederic

here i took 500 bp

ATCGTCTAGGACCGTACTCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCCTTGCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCCTTGGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCCTTGCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGCGTACCGATCGC

in which species?

You could BLAST to see how it compares to known examples. Or run through a gene-prediction model.

But 500bp is too short to be a gene for most eukaryotes.

The sequence you have provided is nonsense - it is just a bunch of repeats of "ATCGTCTAGGACCGTACTCGCGTACCG".

Want to try again with something biologically relevant?