10 Questions 9 Answers 0 Followers
Questions related from Suvarna Narendra
Good morning to all if i have following random DNA sequence then how to find intron and exon manually for Hidden Markov model...
04 June 2023 5,548 2 View
For example i have hypothetical small DNA sequence with 30 bp i.e AGCTTGGCAATCGGTAGGCTAGATCGTACCT. Now i want to count how many transitions between Intron, Exon and Splice site manually. can...
20 April 2023 3,863 5 View
How to train HMM in R. i tried with depmixs4 but show error for my data.
09 April 2023 3,105 2 View
Can anyone give me the numerical example for Layered Hidden Markov Model Layer should be grater than or equal to 2. Thankyou
20 March 2023 7,476 3 View
What is best Software or website to draw Transition diagram or Markov plot freely Thankyou
14 March 2023 3,501 1 View
Good morning, The GLIMMER software available for windows or only Linux. from the official website i am unable to download .exe files. if anyone know pls send me link for windows. Thank-you
02 January 2023 4,417 3 View
Hello Everyone, For example i have 3 states Markov model i.e Healthy, Sick and Death. i collected data in the last year. data form is like yes or no for each. Simple example is Healthy state...
19 December 2022 6,159 4 View
which chromosome affected diabetes(chromosome 6 ?) or any other also. and also suggest me where i can get chromosomes list wise diseases and gene Thankyou
04 December 2022 7,659 7 View
Good morning, How to predict next generation DNA sequence by Hidden Markov model. I read some material about but unable to get for example my random sequence is ATCGAAGTCCCGGATCGATGA from this...
03 November 2022 6,652 3 View
i want to know how to find intron and exon in DNA sequence let my sample be CTGTTGGTGCAATGCCACGGAGACATGGGTGACCTATGGAACATGTTCTCAAACTGGTGAACACCGACGA Thankyou
28 October 2022 209 2 View