Good morning,

How to predict next generation DNA sequence by Hidden Markov model. I read some material about but unable to get

for example my random sequence is ATCGAAGTCCCGGATCGATGA from this sequence how to predict NGS idea please.

Thank you

More Suvarna Narendra's questions See All
Similar questions and discussions