Good morning,
How to predict next generation DNA sequence by Hidden Markov model. I read some material about but unable to get
for example my random sequence is ATCGAAGTCCCGGATCGATGA from this sequence how to predict NGS idea please.
Thank you
You have a lot more reading to do. You can't assemble a contig from one read, regardless of the methodology.
Go talk with your advisor, join a journal club, read more papers.
Katie A S Burnette ,
Thankyou for your suggestion mam
i am reading few articles from NCBI. suggest me any best platform to know more about DNA sequence
Hi Suvarna Narendra
you can also dig in youtube for some courses on NGS technologies.
all the best
fred
Hello, I'm in the process of determining suitable journals for publishing my paper. I'm encountering confusion regarding indexing, publication timelines, and the peer review process. Some...
15 June 2024 1,933 3 View
While working on the modeling of Internal Short Circuits (ISC) in batteries, I have encountered some challenges.
30 November 2023 4,062 2 View
how pesticides affect on fish Genotoxic (DNA damage)
17 September 2023 2,087 1 View
Good morning to all if i have following random DNA sequence then how to find intron and exon manually for Hidden Markov model...
03 June 2023 5,447 2 View
For example i have hypothetical small DNA sequence with 30 bp i.e AGCTTGGCAATCGGTAGGCTAGATCGTACCT. Now i want to count how many transitions between Intron, Exon and Splice site manually. can...
19 April 2023 3,766 5 View
How to train HMM in R. i tried with depmixs4 but show error for my data.
08 April 2023 3,023 2 View
Can anyone give me the numerical example for Layered Hidden Markov Model Layer should be grater than or equal to 2. Thankyou
19 March 2023 7,350 3 View
What is best Software or website to draw Transition diagram or Markov plot freely Thankyou
13 March 2023 3,397 1 View
Hello Everyone, For example i have 3 states Markov model i.e Healthy, Sick and Death. i collected data in the last year. data form is like yes or no for each. Simple example is Healthy state...
18 December 2022 6,063 4 View
which chromosome affected diabetes(chromosome 6 ?) or any other also. and also suggest me where i can get chromosomes list wise diseases and gene Thankyou
03 December 2022 7,549 7 View
I would like to learn more about SPSS and Its application especially in regards to data analysis. Please suggest me how I can learn more about it. Thank you so much.
11 August 2024 9,101 4 View
I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?
11 August 2024 5,138 1 View
Hello, Why do i see this baseline drift when i compare my blank (black) to the sample (blue)? Any suggestions as to why this happened? Thank you!
11 August 2024 3,770 4 View
Willett, Shenoy et al. (2021) have developed a brain computer interface (BCI) that used neural signal collected from the hand area of the motor cortex (area M1) of a paralyzed patient. The...
10 August 2024 7,180 0 View
I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...
10 August 2024 7,429 2 View
How can I use the cif data obtained from rietveld refinement extracted via gsas2, for microstructural analysis using ETEX software?
09 August 2024 7,718 0 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
I'm trying to find a DNA extraction method for fungi that does not require equipment and heating. Is there anyone who can suggest an alternative option? Thank you
08 August 2024 4,733 2 View
Let's say we have a standard, regular hexagonal honeycomb with a 3-arm primitive unit cell (something like the figure attached; the figure is only representative and not drawn to scale). The...
07 August 2024 1,937 1 View