Do you observe the primer dimerization problem when you run a negative control - primers alone without any added template?

Otherwise what you may be observing in your samples would be preferential ampification of a much shorter target that one, or both, of your primers anneal to preferentially.

Which polymerase system do you use and what is your GC % in the primers ?

can you give primer sequences? reduce your primer concentration to 0.25 uL

Try a touch-down PCR and also a temperature gradient. These are the best ways to solve this issue. You can also try reducing the concentration of the DNA.

Do you observe the primer dimerization problem when you run a negative control - primers alone without any added template?

Otherwise what you may be observing in your samples would be preferential ampification of a much shorter target that one, or both, of your primers anneal to preferentially.

@Sudip: I am using Progema GoTaq Flexi kit, GC content is 60%

@Tejas: Left primer: agctggacggcgacgtaaac right primer: gtccatgccgagagtgatcc

@Lekha: I already performed gradient PCR, no primer-dimer at all, but when i repeat back using the same sample or using plasmid, dimerization happens.

@James: No dimerization in negative control.

@Gan - This is a remarkably higher GC%, so try to use DMSO - final conc. 2%.

But what James pointed out is also correct.

Dear Gan,

I would suggest maybe consider a dif approach. Maybe you can consider the following:

1. Hot start PCR

2. Change polymerase to those that can accommodate high GC

3. Add additives like DMSO, betaine, tween.

Hope this helps..

Gan,

Then this is not an issue of primer dimerization - otherwise you would see it in your negative control.

Set up 3 PCRs, using one of your samples under the original conditions.

In the first, use both primers as normal. In the second, only the forward primer, and the third only the reverse primer.

Compare the results.

If the band is the result of a single primer (the forward or the reverse) amplifying a product, then there are two strategies to try:

(1) Do a series of titrations, where you add the primer (not causing the problem) in excess concentration to the primer amplifying the smaller product. PCR and compare the results.

(2) If the single primers causing the problem has a lower Tm - then do the first few rounds (5 cycles) at a higher annealing temperature, and then continue at a lower annealing temperature.

If the band is a result of both primers annealing and amplifying the smaller product, it may be more economical to redesign the primers for your target sequence.

James

May you use other primers?

your primer shows hetero dimer formation, 4 bases of primers are compliment to each other with delta G more negative than -9.. but i don't know why there were no primer dimer in control!

Gan Jen, you optimized the protocol which will allow for more rapid amplification than using basic parameters. Based on my experience, dimers can be eliminated if cycle number is reduced to less than/equal to 35. If you can still obtain the result you desire at reduced cycle number, you can possibly avoid dimer.