Dear Arwa Al

Ct value above 25 for housekeeping genes like GAPDH  is usually wrong and something in your procedure is incorrect.

Possible errors may occur at different steps, more commonly in:

1- RNA extraction: Check the integrity of extracted RNA by electrophoresis on 1% agarose gel. If working on eukaryotic sources you should see 3 visible bands: 28s, 18s and 5.8s rRNA.

2-DNAse treatment: if extracted RNA has lots of DNA contamination and you are performing DNAse treatment before cDNA synthesis make sure that DNAse is fully inactivated before treating RNA. Also be aware of RNAse contamination.

3- RT enzymes are usually sensitive to the expiration date. check the expiration date of your cDNA synthesis kit or your RT enzymes.

Good luck

Dear Arwa Al

Ct value above 25 for housekeeping genes like GAPDH  is usually wrong and something in your procedure is incorrect.

Possible errors may occur at different steps, more commonly in:

1- RNA extraction: Check the integrity of extracted RNA by electrophoresis on 1% agarose gel. If working on eukaryotic sources you should see 3 visible bands: 28s, 18s and 5.8s rRNA.

2-DNAse treatment: if extracted RNA has lots of DNA contamination and you are performing DNAse treatment before cDNA synthesis make sure that DNAse is fully inactivated before treating RNA. Also be aware of RNAse contamination.

3- RT enzymes are usually sensitive to the expiration date. check the expiration date of your cDNA synthesis kit or your RT enzymes.

Good luck

Dear Ramin Golestanian, 

Thank you for your reply,

samples are working, Syber green is new, I think the primers are the main problem but their sequences are perfect!

Hi, Do you use any type of RNase inhibitor? What are your starting RNA amounts? I have done RT-qPCR at single cell level and sterile conditions are absolute must. I don't know how much RNA you have... Are you doing this in one step RT-PCR in one tube or two steps separately? Either what you are amplifying is junk (melt curve data? does it show anything near the Tm of interest or no?) or you have very minuscule amount of RNA that is used...  I have also found that cleaning up my cDNA with paramagnetic beads definitely helps avoid PCR inhibitors. If you do this in one step then don't worry about the cDNA cleanup part although I highly recommend.

Dear Antonios Chionis,

Thank you for your replying, samples are definitely work we have tried that with Taqman polymerase for uninterested gene and sometimes gave two peakes in the Tm with primers!

1) are you sure about your RNA concentrations?

2) are you avoiding salt interference in your reactions (some difficult extractions from complex samples may retain excess of salts, thus interfering with the enzymes)?

3) did you check for primer dimers? even if your sequences are perfect, if they trigger a strong (self)dimerization, the amplification of the targeted template could be strongly underdog.

4) last, but not least: did you perform primer efficiency calculation? this is a "good practice" forgotten more than a few times....

Dear Amilcare Barca,

Thanks for your answer but this my first time I've heard about primer efficiency calculation, I'll look for it and figure out what is it and how it performs?

and all points above this I've checked them and I'm sure 100% there is nothing wrong in the samples and only one gene gave two melting temp. which may indicate primer dimer but the others are not.

Dear Arwa, there is some missing info in your query, which makes really difficult to give you a firm answer.

Like, what primer concentration you have used, what was your template (cDNA) concentration for qPCR, what is the type of your sample; blood, bacteria, tissues, cell lines, FFPE etc.), what was the result in your negative RT controls (wells with original RNA sample and master mix, but without cDNA, done to check gDNA contamination), did you check RNA integrity on gel or Agilent Bio Analyzer before proceeding to cDNA (RT) and the type of cDNA kit you used.

Without knowing these all, there is no choice except to focus on numerous dimensions in order to solve it.

Some reasons for getting a late Ct may include; increased primer concentrations (so PD formation delays Ct), decrease or very diluted template (cDNA), increase concentration of inhibitors in your sample (must follow RNA extraction efficiently), and often a decrease concentration of primers, as they are not enough for your template, and rarely increase ROX (passive dye) in the reaction results in late Ct but if your qPCR machine calibrations are up-to-date so no need to worry about this. So you need to figure out by keeping all these facts in your mind at least.

One very important point to know that did you adjust the threshold properly after the run for each gene? Otherwise, your Ct values are not reliable at all.

If you didn’t perform primer efficiency or primer optimization assay so just try to take primers in the range of 200 – 900 nM (0.2 – 0.9 pmoles / uL), they should work. I personally prefer to work with higher concentrations like 2.5 p mole / uL of primers and at least 25 ng / uL starting template and so far I always managed well.

Often is to increase the concentration of just reverse primer may give you the desired result in terms of Ct values. You can design your own optimization scheme and can check it very easily. I have used this approach and it really did the magic, especially for difficult templates. Easy way to do this let’s suppose if  your forward primer is 1 uL per reaction so add reverse like 1.2 uL, 1.5 uL, 1.8 uL in different ranges and see for any improvements in your Ct.

You can validate your primers even by control cDNA (of same species you are working), which is easily available from your supplier company and check your primers behavior. If primers you have are not working so now you have at least some definite reason.

Remember, that gDNA contamination usually brings Ct earlier rather delaying them. If your cDNA sample is giving improper amplification for your reference or housekeeping genes, it means your template is of poor quality. It’s no doubt that it is one of a quick way to look for your sample quality.

Also try to perform RT (cDNA) step by taking at least 1000 ng – 1500 ng RNA, and use cDNA kit with Superscript IV (SS IV) enzyme, as it is very efficient for degraded and fragmented RNA. As, these days we have up to 5 ug (5000 ng) allowable RNA limit for RT step, so why not to try it.

You can also view my answer I have given some time before, as may be you will get some more concepts.

https://www.researchgate.net/post/High_CP_values_and_multiple_melting_peaks_occur_by_testing_different_primers_concentrations2

With Regards….

Dear Jawwad Ahmad,

Thank you for taking the time to point out all these useful information, but if you don't mind I would ask you one more question please, how to predict amplicon sequence and ct value and also tm of the amplicon of TP53 gene which is one the genes that I want to study, my primers:

F: 5′CCAGGGCAGCTACGGTTTC3′

R: 5′CTCCGTCATGTGCTGTGACTG3'

Dear Arwa, I so far have not tried this approach, as I am not working on sequencing. But what I can say here that a “same sized certain product can have different Tms in various buffers”, as along with the sequence length and composition (GC%-AT%), the Tm is also highly dependent on the ionic strength of a reaction mixture like monovalent, divalent cations & pH etc, even qPCR co-solvents like DMSO can shift the Tm unrealistically. Mainly in R-T-U reagents for qPCR it is not possible to know the exact concentrations of buffer or cations like Na, Mg or K, unless or until the item descriptive sheet of the company for that master mix provides you with these details, which is not likely at all. So let the Sybr Green assay to determine your product via melt curve. As, commonly a single characteristically sharp peak, usually after 74 C denotes a product in usual. Your primers GC content (you have near 63%, which is very fine) determines the strength of your product, that is why mostly the real time PCR products are very efficient and in strong duplexes because of having good GC content and we get dissociation temperature for melt curve at higher ranges.

If you run this product from the corresponding well on at least 2.5 % Agarose (or 6 - 11 % PAGE) by selecting a proper sized marker ladder (we use 25 bp -500 bp ladder by Invitrogen) and compare the size of your product with the corresponding marker band, you will know its size, but here how you will know the actual size in bp and whether this is the desired product or not, so now you need to go reverse at the step of your primer designing to get this answer.

During primer designing by NCBI online tools, we also get the product size in bp and its GC% after the designing of both primers. It is clearly mentioned by the software, you can see it. For qPCR, try the product from 70 -100 bp size, it is ideal, but you can move till 150 bp or so. Hence, now if you simply copy and paste the sequence of product (be careful not the entire gene) from the NCBI software to any product Tm online calculator it will give you the Tm as well, but still it can differ from the Tm assigned by the SG melt curve of your qPCR, which I just mentioned above.

The one very best product Tm calculator, which I prefer is http://eu.idtdna.com/calc/analyzer You can of course look for more you find comfortable.

(Just don’t forget to select qPCR from the parameter sets at top right in this one).

And, also during primer designing, manually you can even calculate your product sequence by subtracting the lower most base number of reverse primer from the lower most base number or value of the forward primer, it will give you the same number of bp of your product, which the software has already shown you. If somebody else designed your primers so you can ask them and can easily learn in just an hour, it is very simple.

Finally to confirm your product amplicon sequence exactly base wise, the best known way is to run the product first on gel after qPCR as I told earlier, and perform gel extraction of correct bands of your product (as dictated by size marker ladder), purify and clean it and perform sequencing through any sequencer you have. I do hope that this will at least resolve some if not all, regarding the doubts you have.

Best Regards…..

Dear Jawwad Ahmad, thank you for all these useful and helpful information you gave me. Thanks for sharing your knowledge, Thank you.