Amplicon lengths are 800bp - 1.8kb. Primers are longer than 'usual' - are in 60nt - 100nt range. Looking for advice on Dos/Donts for such a reaction.
Primer pair for insert 1:
F: 5'-AACGGCCGCCAGTGTGCTGGGAGTTCCTCGAGTCAATTGCTTTTTCCTTGTTCTAGCCAG -3'
R: 5'-CAGAAAGACCAAAGAACAGC -3'
Primer pair for insert 2:
F: 5'-GGATAATGGACATTTGGCATTGAGAGAGGCTGCTTTATAACTTCGTATAATGTATGCTATACGAAGTTA TTAGGTCTGAAGAGGAGTTTACGTCCAGCC-3'
R: 5'- ATAACTTCGTATAGCATAC-3'
Do a few rounds with lower annealing temp first, and then increase the annealing temp to accomodate for the longer primer. I did this with ~25nt primers that had ~45nt extensions for homologous recombination. Initially the primers touchdown with only a portion of the longer primer binding to your template, and so you need a lower annealing temp, whereas after a couple rounds of extension (5 rounds) you can increase the annealing temp to encompass the entire length of the primer binding to template. Not sure if that is similar to what you are doing but it worked well for me!
you may try TAIL-PCR（Thermal Asymmetric Interlaced PCR ）reaction's second cycle program:94℃ 3min,（94℃ 20s,63℃ 1min,72℃ 1min；94℃ 20s,61℃ 1min,72℃ 1min；94℃ 20s,61℃ 1min,72℃ 1min；94℃ 20s,50℃ 1min,72℃ 1min）×13, 72℃ 5min
just use Ex-Taq!
In addition,add some ET SSB （from NEB）may help you get some Better results!
Do a few rounds with lower annealing temp first, and then increase the annealing temp to accomodate for the longer primer. I did this with ~25nt primers that had ~45nt extensions for homologous recombination. Initially the primers touchdown with only a portion of the longer primer binding to your template, and so you need a lower annealing temp, whereas after a couple rounds of extension (5 rounds) you can increase the annealing temp to encompass the entire length of the primer binding to template. Not sure if that is similar to what you are doing but it worked well for me!
Just try a gradient PCR between 50 and 72 using a regular PCR protocol. Most of the times, one of them will work. Regular means 94 for 10 min, 35 cycles of 94 for 30 sec/annealing for 30 sec, 72 for 1 min/kb, and end with 72 for 10 min. Did this hundreds of times for PCRs with long primers. Works most of the times.
Thank you all! All good points - learned so many new things!
Much appreciate your help!!
- Reeteka
@Koen Venken - for this regular PCR you suggested, which polymerase would you recommend? I generally use Pfu Turbo polymerase, has high fidelity, but 'extended' denaturation is not recommended by the manufacturer.
Suggestions?
Thank you!
Reeteka
Huge THANK YOU to Guanfan Mao- for suggesting Tail-PCR. It worked wonderfully!! In fact, of the several approaches I tried, that was the only one that worked. Thanks a million!!!
- Reeteka
Hello I have question relevant to Reeteka Maam,
I have a forward primer of length 112 base pairs and a Reverse of 21 base pairs long so as to amplify a total stretch of approx 1.2 Kb amplicon. Even i have issues with optimizing the PCR conditions can any one suggest an appropriate strategy.
Thank You.,
@Ryan Over no matter how long the extended "tails", the design of overlap portion is usually like that of the regular primer: 18-25bp (it was 25nt in the case of @April Pawluk). In fact, for artificial gene synthesis from scratch in industry, they generally use the similar method (extensions plus 18-20nt primers).
I'm doing something really similar. Did you find a way to make it more specific?
- Badges
- Science method