is this Gibson assembly primer set generated by NEB builder sane?
Hi everyone, I am trying to assemble a gene into a cassette with a left and right homology arm (added those to the gene sequence) a GDP promoter, my Gene of interest with a fusion linker to a GFP and a terminator sequence. The Neb Builder spit out these suggested primers, but one of them seems far too long. Should I modify these? thank you! - Amy
LHA+GDP_fwd GCCAATGGGGGAAAGATG 3'Tm=62.4 3'Ta(annealing temp)=58.7
LHA+GDP_rev catttctgcctccatTAATTACATGACTCGAGCTATTTGTATAG 3'Tm=58.7 3'Ta(annealing temp)=58.7
Q+fusionlinker_fwd cgagtcatgtaattaATGGAGGCAGAAATGTTATATTCTGCTTTGG 3'Tm=69.7 3'Ta(annealing temp)=69.7
Q+fusionlinker_rev ccgctgcccgccgcgCTGCCCGCGCTGCCAACA 3'Tm=73.7 3'Ta(annealing temp)=69.7
GFP+fl_fwd tggcagcgcgggcagCGCGGCGGGCAGCGGCGT 3'Tm=81.9 3'Ta(annealing temp)=72.0
GFP+fl_rev aagtccaaagctgtcGAAGCTTGAGATGGAGATAATGAATTTCTTGCAACTGCATTTTC 3'Tm=77.1 3'Ta(annealing temp)=72.0
TERM+RHA_fwd tccatctcaagcttcGACAGCTTTGGACTTCTTCG 3'Tm=58.8 3'Ta(annealing temp)=55.9
TERM+RHA_rev CATCATATCTGGCACCTAGAC 3'Tm=55.9 3'Ta(annealing temp)=55.9
the lowercase appear to be the homology overhangs, the upper case the main gene F and R primer sequences. this is a linear cassette intended for CRISPR repair template.
It won't help to "modify" (shorten?) it. The primer is almost entirely A/T. That's why it needed to make it so long, in order get it to anneal at 50C. There's a chance that it might work as it is. But it's best to avoid that sequence altogether. Try to find a way to build the construct you want while having only sequences with roughly balanced GACT content in your annealing sites.
Also, break it down into individual 2-point ligation steps (1 insert + 1 vector). Each site has only so much of a chance of working. The more sites you have at the same time, the more likely it will be that one doesn't work, and that kills the entire scheme. It's better to do this step by step, so you can discover where the problem is.
thank you! I don't think I can modify this bad primer w/o modifying the gene sequences it has homology to. So you suggest serial Gibson reactions versus the "one pot" advantage? That does make sense.
Thank you John! I redesigned the Gibson assembly into two parts, which will be linked with a restriction enzyme and ligation. I got much saner primers this time.
NOV 3 Two part Assembly Plan - homology arms and RE built into synthetic Twist sequence
GSA Pot I
LHA+GDP_fwd GCCAATGGGGGAAAG 3'Tm=56.8 3'Ta(annealing temp)=56.6
LHA+GDP_rev ttctgcctccatTAATTACATGACTCGAGCTATTTG 3'Tm=56.6 3'Ta(annealing temp)=56.6
GDP+Q-BamHI_fwd gtcatgtaattaATGGAGGCAGAAATGTTATATTCTGC 3'Tm=63.7 3'Ta(annealing temp)=63.7
GDP+Q-BamHI_rev GGATCCCTGCCCGCG 3'Tm=66.4 3'Ta(annealing temp)=63.7
BamHI for RE assembly inside fusion linker sequence
GSA Pot II
GFP_+_Fusion_Linker_+_BamHI_fwd GGATCCCGCGGCGGG 3'Tm=71.0 3'Ta(annealing temp)=66.8
GFP_+_Fusion_Linker_+_BamHI_rev tccaaagctgtcGAAGCTTGAGATGGAGATAATGAATTTCTTG 3'Tm=66.8 3'Ta(annealing temp)=66.8
Terminator_Sequence_+_Right_Homology_Arm_fwd atctcaagcttcGACAGCTTTGGACTTCTTCG 3'Tm=58.8 3'Ta(annealing temp)=55.9
Terminator_Sequence_+_Right_Homology_Arm_rev CATCATATCTGGCACCTAGAC 3'Tm=55.9 3'Ta(annealing temp)=55.9
- Badges
- Science method