I have been beyond meticulous with NEB Builder, and it has never once worked. I have had success with OE PCR, but NEB Builder fails totally, every time. I get nothing but smear and concatenation primer product.
The issues I've had in the past with NEBuilder I think traced back to overhangs between fragments that were too short. I think it recommends 15-25 nt. I would aim for the higher end of that range. Some polymerases (such as the one I was using to make my PCR fragments) may have some exonuclease activity that shortens the overhangs between fragments below what your anticipated overhang length should be.
thank you Tessa! I use 30 nt overhangs and phusion hot start polymerase. here are my overhang primers
2 part oe pcr separate distal primers, BamHI ligation
LHA_fwd TATACTCTGCCATCAACAATC 3'Tm=56.6 3'Ta(annealing temp)=59.6
LHA_rev ggcagtattgataatgataaactcgaactgaTAACATAGGGATCATGACTCAAC 3'Tm=59.3 3'Ta(annealing temp)=59.6
GDP_fwd tttacaacgttgagtcatgatccctatgttaTCAGTTCGAGTTTATCATTATCAATAC 3'Tm=60.2 3'Ta(annealing temp)=61.5
GDP_rev ccaaagcagaatataacatttctgcctccatTTTGTTTGTTTATGTGTGTTTATTC 3'Tm=58.5 3'Ta(annealing temp)=61.5
82b2_fwd agtttcgaataaacacacataaacaaacaaaATGGAGGCAGAAATGTTATATTC 3'Tm=59.7 3'Ta(annealing temp)=57.1
82b2_rev ATGGTAGATGGATCCCTG 3'Tm=57.1 3'Ta(annealing temp)=57.1
this is a 3 fragment assembly, and I got a similar one working with OE PCR the other day, the last one is low GC % though, which concerns me. I used NEB Builder software to design these primers.
regards, Amy J.
here is some information on the exonuclease activity of phusion, which only occurs in the absence of DNTP where it will degrade primers
https://www.researchgate.net/post/Does_Phusion_DNA_polymerase_degrade_ssDNA_or_dsDNA_or_both
I frequently use NEB builder to design overhang. I keep the overhang length maximum 20 nt. I then analyze the secondary strucure of the overhang sequence with a primer analyzing software such as NetPrimer. If everything looks okay, I order the primer for PCR or order the synthesized dsDNA (such as gBlock by IDT). For PCR, I use Q5 hot start polymerase and so far I never had an issue with this polymerase.
I design primers using the neb builder tool https://nebuilderv1.neb.com/
I have yet to see the neb builder master mix ligate anything, it never ever works and I am meticulously careful with it, and I use 30 bp overhangs. It just failed now today AGAIN - nothing but a 250 nt junk band on the gel. Back to OE PCR, that at least works once in a while, one.fragment.at.a.time....
HI Amy. I have been using NEBuilder for several years and it tends to work really well for me (I use half reactions -10 µl- to extend the number of reactions I get). So here's some things to consider. 1. You said you got 200 to 300 colonies with the competent cells and circular vector. is this number calculating out to 10 8 CFU or better? Anything less is not going to work for a complex multi band construct. 2. Are you gel purifying your bands, getting ODs for each, and checking to make sure that the molar ratios for all components are correct? 3. When you say you get a 250 nt. junk band what does that mean? If you are checking by just colony pcr it would be worth it to miniprep your few colonies and figure out what they are. 4. Also, have you tried amplifying with just one primer/rxn to make sure that each band that you're getting is a true primer-primer amplicon? If even one is wrong then the whole thing won't work. 5. The fact that even your control doesn't work suggests strongly that the issue is either the competent cells or the rxn mix is off.
thanks Dianne! I calculate the molar ratios of the fragments totaling together 0.01 to 0.2 (depending on the reaction) by the equation pmole = (X ng * 1000) / (bp length * 650 Daltons)
I have been having better luck with OE PCR and paperclip assembly.
https://www.youtube.com/watch?v=JcYZiGjhqVk&list=PL7dHSJLqgNa1yfuhZBx8WHwxXtupzGAKG&index=2&t=0s
The junk band looks like primer dimer concatenation. I was actually trying to assemble a linear construct, which NEB tech support told me was possible using NEB builder master mix and the correct molar ratio of fragments. They do need to be run one by one, for troubleshooting, you are correct. But that does defeat the purpose of the whole product ;-) I designed my primers with NEB builder software to have 30 bp overhangs.
Yeah, I would use overlap assembly if just putting together a linear product. NEBuilder really shines when generating a multi insert plasmid; my daughter actually successfully used it to put together 5 fragments in her first lab research job as a second year undergrad!
- Badges
- Science method