this is very helpful https://www.researchgate.net/post/What_are_the_causes_for_the_appearance_of_DNA_bands_other_than_the_specific_band_on_the_agarose_gel

I am going to try this with a higher annealing temperature, which Q5 polymerase seems to tolerate. Maybe 65 degrees versus 59 I used here.

Since your template size is small I suspect non specific primer binding is not the answer although you could check the template sequence but if you had a long and high GC rich template it might be possible for the template to form a loop via GC binding or a G quadruplex. If the enzyme read across the neck of the loop then a short amplimer incorporating both primers may be possible. Add dmso or 1m betaine final concentration to your pcr and also run a gradient of annealing temperatures in case the highest annealing temperature does not allow odd structures to form, Sequencing the products would probably supply the answer

I extracted the dna from that ligation product band with the "freeze and squeeze" method, and I have a pcr amplification underway right now. Freeze and squeeze generates almost 1 milliliter of water with not much DNA in it, so it has to sit in a speedvac for 2 hours to get back about 20 ng dna (Update : got a healthy 56 ng/ul pcr run from 1 ng template)... running the gel now.

i can not get the pcr from a gibson assembly to have one band, they are always sporting nonspecific bands - often w/o the heaviest correct band at all

pcr conditions : Q5, 1 ng template 2.3kb, 1 ul dmso, 1.5 ul forward and reverse primer at 10nM with a 63 degree annealing temp at 20 seconds per cycle, extension at 72 degrees for 1:30, 1 ul dntp. 25 total pcr cycles. 34 ul mgbw, 10ul vortexed Q5 buffer

got a garbage gel result (att image)

I am running pcr on a sample of the post gibson assembly dna (only 1 ng) to get enough dna to run a gel and check the size.  I am not transforming yet.  I also cloned from dna extracted and purified from a single correct sized band, got 56 ng/ul but on the gel it is not 2.3kb anymore it is sometimes a smear or some junk  at the end of the ladder.  what i am trying to do is get all 4 of the pieces assembled.  i successfully cloned all 4 pieces with gibson overhangs and checked their size on a gel.  2 gibson pots each get two pieces.  then the 2 products of these have a fusion linker with a BamHI site to connect all 4 pieces, but I am not even that far yet.

the point of this is to assemble a cassette with promoter, gene, fusion linker, gfp and terminator sequence. 2 gibson pots 2 pieces each, linked by BamHI in the fusion linker.

all the 4 pieces cloned and ran correctly at the right size on the gel.  the primers are from neb software design.  having problems getting the 2 gibson assemblies of 2 parts each verfied on gel.  got the first, larger one but with 2 weird nonspecific bands.  got the smaller one with 1 nonspecific band,  but when i subcloned the larger one to verify again from dna extracted from the gel band (and it was a healthy 56 ng/ul result) I just got junk (see below)

maybe the nonspecific bands are gel contamination? maybe ignore them?  here is the one gel i got the heaviest correct band on, (first image in this thread) but subcloning from that band failed even with a nice 56 ng/ul pcr from only 1 ng template

I designed and ordered the Gibson primers with overhangs for a 4 part final assembly.  Then I tried to assemble it in 2 pot of 2 fragments each.  The overhangs are not in the primer sets for the double 2 pot assembly.

I am not sure if this actually causes a problem though.

here is the primer set I ordered and used versus one for two (2) fragment Gibson reactions

 dec 30 gibson design check

  4 part assembly

  GDP_+_LHA_fwd     GCCAATGGGGGAAAGATG 3'Tm=62.4 3'Ta(annealing temp)=60.3

GDP_+_LHA_rev     ttctgcctccatTTTGTTTGTTTATGTGTGTTTATTCG 3'Tm=60.3 3'Ta(annealing temp)=60.3

Q_fl_BamHI_fwd     ataaacaaacaaaATGGAGGCAGAAATGTTATATTC  3'Tm=57.4 3'Ta(annealing temp)=57.4

Q_fl_BamHI_rev     tcctaggattggATGGTAGATGGATCCCTGC 3'Tm=58.5 3'Ta(annealing temp)=57.4  (OVERHANG versus 2 pot primers)

gfp_+_fl_BamHI_fwd     tccatctaccatCCAATCCTAGGATCCCG 3'Tm=57.5 3'Ta(annealing temp)=56.8

gfp_+_fl_BamHI_rev     tggtaaccttagGAAGCTTGAGATGGAGATAATG  3'Tm=56.8 3'Ta(annealing temp)=56.8

term_RHA_fwd     atctcaagcttcCTAAGGTTACCAAGGCTGC      3'Tm=56.3 3'Ta(annealing temp)=55.9

term_RHA_rev     CATCATATCTGGCACCTAGAC                  3'Tm=55.9 3'Ta(annealing temp)=55.9

double 2 part assembly

  gdp_fwd     GCCAATGGGGGAAAGATG      3'Tm=61.0 3'Ta(annealing temp)=59.1

gdp_rev     ttctgcctccatTTTGTTTGTTTATGTGTGTTTATTCG      3'Tm=58.1 3'Ta(annealing temp)=59.1

Q_fwd     ataaacaaacaaaATGGAGGCAGAAATGTTATATTC      3'Tm=57.6 3'Ta(annealing temp)=58.3

Q_rev     ATGGTAGATGGATCCCTG      3'Tm=57.3 3'Ta(annealing temp)=58.3 (NO OVERHANG versus one pot primers)

 gfp+fl_fwd     CCAATCCTAGGATCCCGC      3'Tm=62.4 3'Ta(annealing temp)=59.0 (NO OVERHANG versus one pot primers)

gfp+fl_rev     tggtaaccttagGAAGCTTGAGATGGAGATAATG      3'Tm=58.0 3'Ta(annealing temp)=59.0

term_fwd     atctcaagcttcCTAAGGTTACCAAGGCTG      3'Tm=56.7 3'Ta(annealing temp)=57.4

term_rev     CATCATATCTGGCACCTAG      3'Tm=56.4 3'Ta(annealing temp)=57.4

I have overhangs in my primers that the 2 pot assembly does not have in the reverse primers.

still not sure if this is actually causing problems or not! since they don't anneal, are unnecessary overhangs even problematic?

they don't even contribute to Tm.   Might just try a 4 fragment one pot Gibson today, I have verified by gel that I have the 4 fragments cloned with the overhang primers.

A subtle difference, easy to accept software output w/o examining it closely enough. A dumb mistake on my part.

this another approach : https://www.researchgate.net/post/How_to_join_two_or_more_fragments_using_primers

"joining together either two or three PCR products. You need a 40bp overhang on one of the PCR products that is complementary to the end of the adjacent PCR product (add this with your initial primers). If you are trying to PCR all three fragments together in one reaction, try instead to attach two and then add the third one on in a separate reaction - this always works better. Additionally, you need to allow the PCR products to anneal (at higher than normal annealing temp so you don't get nonspecific hybridization along the long PCR products that are non complementary) (I use 68 degrees), and fill in to make a double stranded product BEFORE adding the terminal primers. So basically have everything in your PCR reaction EXCEPT primers, do 2-3 cycles of annealing and extension, and then you should have double stranded full-length products. Then add your primers to the distal ends of the fragment and do a normal PCR reaction. "