Hi Sindhushree,

As Fabio and Ali say, you certainly can do qPCR on mitochondrial transcripts - I have done it myself in an earlier project.  However, I just wanted to add a couple of important points to keep in mind (most of which I learnt the hard way from doing it myself!).

- As Fabio points out, transcripts from the mitochondrial genome have some unusual features reminiscent of bacterial transcripts; in particular, not all have poly(A) tails, and many are bidirectional.  For this reason, I usually avoided doing my cDNA synthhesis with oligo(dT), and instead used random hexamers or gene-specific primers (GSPs).  The latter option also allows you to amplify targets with strand specificity.

- While the mitochondrial transcripts are very abundant (especially the ribosomal RNAs), the mitochondrial DNA genome is very abundant too - there are up to thousands of copies per cell, and furthermore, being tightly-packed and circular, it's more resistant to standard DNAse treatments than nuclear DNA.  I had to treat my samples very hard with DNAse, and also had to be particularly thorough with my -RT controls to ensure I was detecting true RNA signal and not contaminating DNA.

I'm happy to send you the sequences of the primers I used (I looked at the rRNAs and a few genes), but can you confirm the species you're looking at - is it human?

Best of luck - I hope that helps!

Dan

Hi Sindhushree, 

While mitochondrial gene expression has specific features reminiscent of prokaryotic transcription (bidirectional, polycistronic transcripts, POLRMT, TFAM dependency), you can very well perform qPCR as you would for any nuclear transcripts.

Here are the sequences for validated, human PTGS2 (COX2) primers :

fwd: TCAGCCATACAGCAAATCC 

rv: TATACTGGTCAAATCCCACAC

Have a look at the GETprime database (link), which provides a vast collection of validated, isoform-specific primers for numerous species. 

http://bbcftools.epfl.ch/getprime

Hi Sindhushree,

As Fabio and Ali say, you certainly can do qPCR on mitochondrial transcripts - I have done it myself in an earlier project.  However, I just wanted to add a couple of important points to keep in mind (most of which I learnt the hard way from doing it myself!).

- As Fabio points out, transcripts from the mitochondrial genome have some unusual features reminiscent of bacterial transcripts; in particular, not all have poly(A) tails, and many are bidirectional.  For this reason, I usually avoided doing my cDNA synthhesis with oligo(dT), and instead used random hexamers or gene-specific primers (GSPs).  The latter option also allows you to amplify targets with strand specificity.

- While the mitochondrial transcripts are very abundant (especially the ribosomal RNAs), the mitochondrial DNA genome is very abundant too - there are up to thousands of copies per cell, and furthermore, being tightly-packed and circular, it's more resistant to standard DNAse treatments than nuclear DNA.  I had to treat my samples very hard with DNAse, and also had to be particularly thorough with my -RT controls to ensure I was detecting true RNA signal and not contaminating DNA.

I'm happy to send you the sequences of the primers I used (I looked at the rRNAs and a few genes), but can you confirm the species you're looking at - is it human?

Best of luck - I hope that helps!

Dan

Very good points brought up by Dan ;)

@Ali,

COX2 (PTGS2) catalyzes the terminal ETC step.

@ali - thank you for your reply! when downloading the fasta file of each mitochondrial gene of interest, should i just look at cDNA (transcripts), coding sequences (CDS), or exons? (see attached image)

@fabio - thank you for your reply! I might be confusing cyclooxygenase 2 (PTGS2) and cytochrome c oxidase 2 (COX2/MT-CO2) - could you please direct me to a paper showing PTGS2 mediating the final step of ETC? PTGS2 would be much easier to measure as a proxy for ETC functionality! 

@dan - thank you for your reply! I will certainly make sure to avoid oligoDT cDNA synthesis and make sure to increase the DNase treatment. What controls did you use for making sure you didn't have DNA contamination? I am working with human cells so any primers you've validated for mitochondrially encoded genes (especially for the ETC complex subunits) would be very helpful - thank you!!

My apologies, Sindhushree. I confused the ETC enzyme Cytochrome C Oxidase 2 (MT-CO2/MT-COX2) with the Cyclooxygenase involved in prostaglandin biogenesis (COX2/PTGS2). 

Here are the primer sequences for the mitochondrial gene encoding the ETC enzyme MT-CO2. Follow the link for additional options.

fw: ACGCATCCTTTACATAACAGAC

rv: GCCAATTGATTTGATGGTAAGG

Best,

http://bbcftools.epfl.ch/getprime

@Fabio - no problem, thanks for getting back to me so quickly! :) 

I looked up primers for MT-ND3, MT-CO1, MT-ATP6 on GetPrime and checked them on another tool called SMS PCR Primer Stats (see link). A lot of them gave me a self-annealing warning. Have you had success using the primers from GetPrime? Do you know of any other ways to check the primers ahead of time? 

Since measuring mito-RNA is tricky, I want to make sure my primers are good to minimize troubleshooting time ...so any advice you have on how to check the primers ahead of time would be great!

Thanks again!

- Sindhu

I did use MT-CO2 primers once on cDNA from K562 cells and extracellular vesicles. The melt curves and amplification plots were consistent. My primer sequences were retrieved from GETprime but I can't confirm which pair was used at the moment.

In my experience, GETprime is a reliable tool. To be safe, I would recommend ordering a few different pairs and testing them out. You won't need much cDNA and should actually dilute diligently as these transcripts are highly expressed. 

@fabio - thank you!! :) 

Which gene is favoured as a reference input ? I think using GAPDH or beta-actin is not appropriate because they don't reflect the amount of mitochondria. What about rRNAs encoded by mitochondrial genome ?

Hey Sindhushree Raghunandan , I am trying to look mouse mitochondrial gene primer for qpcr. I saw your post here and wanted to ask if you had any luck with that ?

I would like to ask one thing, which mt Gene should I choose for estimating relative amounts of mt-DNA contamination by QPCR in plasma sample of mice and human?

Hi Deepika,

You can choose any of them, really - none of the genes are spliced in mt-DNA, so there's no chance of you picking primers that span an exon-exon junction. Any of them should give you a product from mtDNA as well as mtRNA transcripts (hence the contamination problems discussed above). Of course, you'll need different primers for the mouse and human samples.

Hope that helps!

Dan

Hi I have same problem.I am trying to do qRT PCR for mitochondrial RNA. I use a cDNA mix which has oligo dT which binds to poly A tail. But my Ct values are lower close to 14. And the Ct values are same for all the transcripts I analyse. Can anyone suggest me ideas to overcome this issue?