I need to do PCR using the following primers:
Forward primer: (27bp) TCGCCACCATGGATTACAAGGATGACG,GC%=51.9%，Tm 62.3C.
Reverse primer: (56bp)
ATCCTTACTTAGTCAGAAAAGATTTTCTTCAAATATTGACAATAGATCACTCTGGA
GC%=30.4%, Tm 63C.
Need to amplify 4117bp fragment from plasmid, really want to get suggestions about how to set up thermal cycle especially annealing temperature? Thank you very much.
Hi there,
Before trying to optimize a PCR protocol, I always have a go with pretty basic protocol using Phusion polymerase with denaturation at 98°C for 30sec, an annealing temperature of 55°C 30sec and extension at 72°C with 20sec/kb in HF buffer. If it works, perfect. If it doesn't the optimization step will be actually guided by the result of the first run : presence of bands or no band at all. Main parameters to consider : annealing temperature, nature of buffer and possibility of additives. But always change parameters one by one otherwise the understanding of what is going on would be more than difficult.
I used Q5 master mix purchased from NEB. The thermal protocol that used is 98C 30'', 35cycles of 98C20'', 63C 20'' and 72C 4'30'', the total extention is 72C 2'. Do you think I need to use 55-57C as annealing temperature? thank you very much.
Hi again,
As I already said I always try at 55°C first because melting temperature calculation is highly dépendent on the program used (and the program varies a lot from company to an other) therefore one can really rely on it. Apart from that I find your extension time too long as Q5 is given has 20 to 30 sec per kb so 2.5 minutes extension should be enough. On the contrary, I would go for a longer final extension in order to optimize full length product yield.
I am running the PCR machine and will let you know the result. Thank you
- Badges
- Science method