8 Questions 11 Answers 0 Followers
Questions related from Qinhong Wang
I tried Gibson Assembly to do cloning recently but all failed. I used Snapgene to get primers for the amplication of vector and fragment. PCR worked well. Vector is 2.6kb and Fragment is 4.3kb....
25 August 2023 3,214 3 View
I would like to insert a piece of DNA fragment ( about 270bp) into the map of the plasmid in Snapgene. Does anyone know how to do that? Thank you so much!
10 July 2023 5,821 1 View
I found that in NCBI, sometimes it is hard to find the complete genomic sequence of a gene, does anyone know if there are other websites good for searching for genomic sequence? Thank you.
19 June 2021 7,561 7 View
I would like to use two or three sgRNA to KO target gene using CRISPR technology, these sgRNAs need to target the different exons, how distant between the sgRNAs would be good to efficiently KO...
16 October 2018 8,515 5 View
My one primer for PCR is GC-rich primer: CGCCACCGCGTGTACGGTGGGAGG; GC 75%, another primer is: ATCCTTACTTAGTCAGAAGAGATTCTCTTCGAATATTGAC; GC 35%. Using these primers, I could not get the expected...
09 August 2016 2,295 4 View
I need to do PCR using the following primers: Forward primer: (27bp) TCGCCACCATGGATTACAAGGATGACG,GC%=51.9%，Tm 62.3C. Reverse primer:...
20 June 2016 3,890 5 View
I would like to make a C-terminal mutant, do I need to keep ATG as a first codon? Thank you. Best, Qinhong
01 January 1970 5,637 2 View
I made HA-tagged FANCA FL construct by myself, and checked the expression of both HA and FANCA protein a few days ago. It turned out I could see the FANCA band when I used FANCA antibody, but...
01 January 1970 5,068 0 View
