My one primer for PCR is GC-rich primer: CGCCACCGCGTGTACGGTGGGAGG; GC 75%, another primer is: ATCCTTACTTAGTCAGAAGAGATTCTCTTCGAATATTGAC; GC 35%. Using these primers, I could not get the expected band, only smear. Any suggestion for this situation? I did not use 5%DMSO. Thank you very much.
Hi Qin
I have evaluated the melting temp of your 2 primers using the oligo analyser tool
https://www.idtdna.com/calc/analyser
- Your GC rich primer has a predicted melting temp of ~ 70C
- Your opposing primer has a melting temp of ~60C
- For PCR to stand a chance of working the Tms of your primers must be compatible and a 10C difference renders them incompatible
- Ideally your primers Tms should be within a 2C difference
- Moreover using the following program
http://biotools.nubic.northwestern.edu/OligoCalc.html
- A hair pin might potentially form in your GC rich primer:
Potential hairpin formation :
5' CGCCACCGCGTGTACGGTGGGAGG 3'
3' Complementarity:
None !
All potential self-annealing sites are marked in red (allowing 1 mis-match):
None !
- Thus I would re design your primers as described in the attached document
- Having made primers with compatible Tm's initially perform PCR where you evaluate an annealing temp gradient, beginning @ TM-3C of you lowest Temp primer and progressing to an annealing temp of Tm +2 of your highest Tm primer in 1C intervals
- In other words rxn #1 = Tm-3C annealing temp; #2 = Tm-2C; reaction #3 = Tm-1C annealing temp....up to Tm+2
- Everything else in your PCRs should be the same except this incremental annealing temp gradient
- To reiterate these predicted Tm's should ideally be the same or within 2C of one another; NOT 10C
Use DMSO
you can use higher annealing temperature followed by lower. touch down PCR
OR may be asymmetric PCR
Hi Tejaz and Qin
yes there is a possibility that TD might work and is designed in part to deal with incompatible primers in terms of Tm
See therefore a link to a prior answer of mine which described the method and you could adapt
However, a 10C difference is never acceptable for primer pairs and it is always better to fix these problems from the bottom up, i.e. redesign the primers than to evaluate troubleshooting PCR techniques with sub optimal primers; Unless absolutely necessary (which in part is why these techniques exist)
https://www.researchgate.net/post/Are_touchdown_and_gradient_PCR_same#view=57974683ed99e1a7c83ca911
Thus during the TD phase you would go from 70C down to 60C in 1C intervals over 10 cycles but I agree with Artur: This is a long shot and unlikely to work so better to redesign your primer(s)
- Badges
- Science topic