There is no "exact" annealing temperature of a pcr reaction. I would start the pcr with some degrees below the lower Tm-value (3 - 5 °C). If there are non-spezific bands, rise the temperature stepwise (1 - 2 degree per step). Or, if possible, you can perform a gradien pcr with rising annealing temperature (eg 49, 51, 53, 55, 57).

But you should keep in mind, that the MgCl2 conzentration is more critical for performing a pcr

There is no "exact" annealing temperature of a pcr reaction. I would start the pcr with some degrees below the lower Tm-value (3 - 5 °C). If there are non-spezific bands, rise the temperature stepwise (1 - 2 degree per step). Or, if possible, you can perform a gradien pcr with rising annealing temperature (eg 49, 51, 53, 55, 57).

But you should keep in mind, that the MgCl2 conzentration is more critical for performing a pcr

Hi, I hope this will also help you: http://medicine.yale.edu/labs/henegariu/www/tavi/p08.html

Cheers, Nadine

i think 53C will work in this case, if not then go for gradient PCR (51-55C)

Thank you all....

I often consult this paper for any additional considerations of calculating annealing temperatures: "Optimization of the annealing temperature for DNA amplification in vitro" by Rychlik, Spencer, & Rhoads in Nucleic Acids Research (PMID: 2243783). Make sure you check the published Erratum which contains a correction to the formula (in Nucleic Acids Res 1991 Feb 11;19(3):698).

Tm of primer is temperature when primer can band with DNA at 50% of ratio. if the annealing temperature is higher or lower 5 degree compare with Tm, that ratio will be from 20%-40% case by case. In you case I think you should set annealing temperature at 53°C that perfect for primer 1 and good enough for primer 2.

One more thing is I always follow the Tm of primer which set by marking company even my primer can have other Tm used at other article

The correct annealing temperature may also depend on the polymerase that you are using. Phusion, for instance, tends to work better with higher annealing temperatures. Try checking the user's guide for your polymerase to see if it has any temperature specifications.

http://www.thermoscientificbio.com/webtools/tmc/

Best way..! I feel is this.

cheers,

Hi dear Abhijit

You have 2 choices:

First, you can use the annealing temperature of your Primers that noted on their vials

Second, you can run a temperature gradiant PCR to find the best annealing temperature

Sincerely

Although, all comments are very good advices but in my experiences, the best Tm is Base Stacking Tm of the primer that includes Mg2+ and primer concentration in its calculation. Three degree below this Tm is the best annealing temp. This always works.

You can calculate this Tm from the below link.

http://www.biophp.org/minitools/melting_temperature/demo.php?formula=Base-Stacking

I would say more or less the same as Milad. Usually i use oligocalc (salt corrected Tm) http://www.basic.northwestern.edu/biotools/OligoCalc.html

and then i use a few degrees lower. But if i have the time i run a mini gradient, e.g. 55, 57.5, 60°C to quickly find out a Tm which works nicely (comes in handy when testing like 96 Primerpairs at once --> 3 plates and u r mostly done)

Do a Annealing gradient between 45-60, it should work..

I would rather prefer to say Ta is less than Tm of a primer with the lower temperature. Still there are conditions where Ta of 1oc less than Tm is doing good. Whatever the case MgCl2 con. plays a great role in determining the efficiency of the Taq and therefore the PCR result.

it may help

http://www.lifetechnologies.com/au/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html

But the best way to find it is running gradient PCR

Oligo melting temperature and PCR annealing temperature

Melting temperature is the temperature at which 50% of the oligo and its perfect complement are in duplex.

PCR annealing temperature a few degree (4-6) lower than the melting temperature is usually used to increase the probability of primer binding.

To calculate melting temperature or for more information, please see BioToolKit or Primo Online.

Simple rule

Melting temperature (Tm) = 4 * Number of G or C + 2 * Number of A or T (°C)

Nearest Neighbor

The Nearest N predicts melting temperature using the "Nearest Neighbor" model (Jhon SantaLucia, Proc. Natl. Acad. Sci. Vol. 95, p1460-1465 (1998)), which is more accurate.

Alternative model

Calculations using the following formula

Tm = 64.9 + 41 * (Number of G & C - 16.4)/oilgo length - 500/oligo length (°C)

are usually in agreement (± 3 °C) with the results using the Nearest Neighbor model.

Correction for salt

Tm([Na+]) = Tm(1M NaCl) + 11.7 * log10([Na+]) (°C)

(Jhon SantaLucia, Proc. Natl. Acad. Sci. Vol. 95, p1460-1465 (1998))

YOU may use this calculator 

http://tmcalculator.neb.com/#!/

Thank you |for all these answers ... I am very grateful and happy for these web site they help me in my research . 

HI everyone. pls, most I find the primer sequence that I used to amplify the gene-of-interest from the gene sequence (i.e. after sequencing) before proceeding with cloning ?. Please help me with

Please help me with answer or your opinion regarding this critical issue. Thanks

i am doing telomerase activity assay by TRAPEZE telomerase detection kit. but i cannot get bands in negative phag gel. give me idea for geting results.

hi everyone. I work on the wheat DNA, and searching Leaf Rust genes which is code by Lr for the primer. I have been trying different tm for the primers but still cant find the correct tm. do you have any suggestion for the Lr9, Lr10, Lr19, Lr24 primers for the wheat leaf rust. Icoulnd't  find the correct pcr reaction thats why ı can't see genes place on jel:(

@Ozlem, you are working on wheat leaf rust effector genes or leaf rust resistance genes? I think you are trying different anneling temperatures not Tm because you can not optimize Tm but annealing temperature (Ta). If you are trying to optimize Ta for your genes, use temperature gradient set up on your thermocycler. Set the minimum Ta as 5 0C less than the average Tm of your F and R primer. Let's suppose the average Tm of your primer is 58oC hence set your Ta as: 53, 54, 55, 56, 57 and 58oC. Run gel and select the Ta resulting in specific band. If all the Tas resulted in non-specific bands, try again by increasing the Ta like 55, 56, 57, 58, 59 and 60oC. Do the repeatation until you get  a Ta with specific band.

Good luck

Interesting responses. Temperature gradient for Ta should get the issue sorted. You should subsequently get bands on the gel provided you have DNA extracted

The Tm  of a molecule is dependent on its sequence, however the relationship between sequence and Tm is not simple. In general the greater the GC content of DNA the higher its Tm.  The Wallace formula can be used to give a rough estimate of Tm.

Tm = 2(A+T) + 4(G+C).

There are other formulas for estimating Tm such as nearest neighbor which may give a more accurate measure of Tm.  Additionally, there are a number of web sites that will calculate Tm using these or other formulas.  

Two issues are critical for Tm. 

The two primers should have a similar Tm.

The Tm  should be within55-72º, around 60º is ideal.

i kindly inform you that you can use the gradient as the colleague were previously mentioned but i saw that your primer GC content is lower than identical which must be 40-60% . your GC content will cause formation of non specific product and dimers with my respects.

Thanks for the feedback. It is very informative

how do you obtain GC content of your pcr product??

I am also facing problem with anealing temp. one of my primer tm is 61.8 with 28.1% GC and and another one is 70.8 with 35.2% GC. I also need a suggestion for the PCR annealing temp. Product size is 452bp 

Annealing temperature of your PCR reaction is 5oC less than the primer's Tm i.e. 52.8 - 5 = 47.8 oC.

For those having wide Tm difference between F & R primer; I guess you use Gradient PCR machine which allows for different Ta during same reaction and cycles. @Begum, you may TROUBLESHOOT the Ta between 53oC - 65oC or something like that.

Dear all.

Thank you for all who answered, because it's a good information.

Take my thank dear( Jibran Sauleh) for this web site.

Respects

All the comments are very good. But whatever I have noticed as per experience in molecular work is that you should set your annealing temperature at 3 degrees lower than the given melting temperature of your primers...it Works every time if your primers are well designed.

What if both primers have very different Tm, should I used the lower one to calculate the annealing temperature or an average?

Hi Hiba,

If there is a vast difference in both the Tm, try to take the mean of those two and then place a gradient which will have 5 temp above the mean value and five temperature below the mean value.

There is no such a thing as an exact calculated Tm value. This depends on the method used for calculations and the thermodynamic model used, which is never perfect. If you want to be exact you need to perform a gradient, but bear in mind that what you get is the Tm relative to your assay, not your primers. So if you change mastermix, Mg, and in general your reaction, your result may change. If you want to have an idea of your theoretical Tm for your primers, I suggest you to folow Biorad guideline:

"Tm should be recalculated using Primer3. Suggested settings: 50 mM Na+, 3 mM Mg++, 1.2 mM dNTPs, 250 nM annealing oligo, SantaLucia/SantaLucia"

Obviously you have to try and adapt the above value to your assay, so if you use different concentrations of Mg or different concentrations of primers, change it accordingly

Agreed to @ Guido A Drexler

https://www.thermofisher.com/sa/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html

You can use the above link.

You can simply optimize by performing gradient PCR with odd annealing in the range 53±4 which may include 49, 51....The results of the gradient PCR will show the best annealing temperature which will work best for the primer and matches the efficiency of your thermocyclers

Thank you all. I am also passing through the same problem too...Not getting PCR results... But I am surprised... because Tm calculation of my primers sequences is calculated different by different websites. moreover, the Tm mention on vial of stock primers is different.

Good answer dear Rajanya Banerjee its useful and appropriate for mean value and the gradient temperature.

How do I known the annealing temperature of PCR reaction?

Primer Sequence is – i> F: ATCTTCCGAAGAATACAAGA and R: CTCAACCCCTATTTAACCTTT . AGAP2 gene , SNPs rs12368653.

I work on multiple sclerosis with Vitamin D

Asaad Mohammed Ataa You can calculate the Tm by following formula:

Tm = 2 X (A+T) + 4 X (G+C)

This will give you approx tm of your primers OR you can either use online tm calculators that are available online:

https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator

http://www.thermoscientificbio.com/webtools/tmc/

When choosing the temperature for the PCR annealing step a good starting point is Tm - 5°C.

Asaad Mohammed Ataa I do agree with Demir Ozdemir. Just use the equation mentioned above for Tm calculation and then substract with 3 or 5 to get Ta. There are a lot of websites that can calculate the Ta directly, you just need to copy and paste the primer sequences only.

I agree with Demon just that you will have to subtract 5 oC from the final value obtained from his formular. That is the starting point and if you keep on having non-specific amplifications, you can gradually be adding the annealing temperature. Remember, if you have 2 primers, you will have two annealing temperatures. In this case, use the lower annealing temperature.

Many companies still use obsolete, faulty formulas for primer Tm calculations. The most accurate Tm predictions are those based on the nearest neighbor method and salt-correction. You can find an online Tm calculator and references to original papers here:

http://molbiotools.com/primerinspector.php

You can go buy gradient PCR and use CLONE 9 software when design primer

Where gradient PCR may not be easily accessible, methinks the manual calculation can do justice to your puzzle.

From the sequences:

Tm: 4(G+C) + 2(A+T)

4(6+2) + 2(6+12)

Tm forward=68.

..…...............................

Tm: (4+5) + 2(13+4)

Tm for reverse= 70

...........................................

For optimum annealing temperature:

0.3(Tm of primer) +0.7(Tm of product) - 14.9

0.3(68) +0.7(70)-14.9

(20.4+49)-14.9=54.5.

Annealing temperature of *54.5* may be of high yield for workability.

How to calculate annealing temperature for these primers (Nisin gene)

F'-AAGAATCTCTCATGAGT

R'-CCATGTCTGAACTAACA

F'-AAGAATCTCTCATGAGT tm 47.5

R'-CCATGTCTGAACTAACA tm 49.4

final is 51.9

You could also use primer alignment software window on the NCBI website to design your

Primer quest can help

Hello

You could also use Tm calculator software window on the Thermofisher website

https://www.thermofisher.com/sa/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html

Good Luck

You can use Oligoncalculator

Generally 3 degree on the lower side of average Tm of forward and reverse primer is the annealing temperature for most of successful PCR amplicon. If no result come, check through gradient of 1 degree

Perform Gradient PCR. Also, change concentrations of the PCR reaction mixture.

Try several online calculators and compare the answers you get.

http://www.genomecompiler.com/tips-for-efficient-primer-design/

Tm calculator software window on the Thermofisher or NCBI website could be helpful.

by using Tm calculator software

I use the NEB Tm calculator. Has worked for me several times. But sometimes when it doesn't I do the gradient PCR.

Thank you all especially Saleh Alkarim for this link it's very useful for my question.

Best regard.