3 Questions 3 Answers 0 Followers
Questions related from Asaad Mohammed Ataa
Hello everyone, I am currently looking for tools to recovery viral genomes from bacterial genomes, not metagenomes. However, I have only found tools that are designed for retrieving and studying...
29 July 2024 8,950 1 View
How can I calculate the target pcr product size from the primer position in source sequence , cleavage fragment? primer sequence F: 5′-ATCTTCCGAAGAATACAAGA-3′ R: 5′-CTCAACCCCTATTTAACCTTT-3′ Gene...
17 October 2019 7,985 4 View
How do I known the annealing temperature of PCR reaction? Primer Sequence is – i> F: ATCTTCCGAAGAATACAAGA and R: CTCAACCCCTATTTAACCTTT . AGAP2 gene , SNPs rs12368653. I work on multiple...
23 September 2019 891 1 View