4 Questions 8 Answers 0 Followers
Questions related from Asaad Mohammed Ataa
Hello everyone, I am currently looking for tools to recovery viral genomes from bacterial genomes, not metagenomes. However, I have only found tools that are designed for retrieving and studying...
29 July 2024 9,277 1 View
How can I calculate the target pcr product size from the primer position in source sequence , cleavage fragment? primer sequence F: 5′-ATCTTCCGAAGAATACAAGA-3′ R: 5′-CTCAACCCCTATTTAACCTTT-3′ Gene...
17 October 2019 8,047 4 View
How do I known the annealing temperature of PCR reaction? Primer Sequence is – i> F: ATCTTCCGAAGAATACAAGA and R: CTCAACCCCTATTTAACCTTT . AGAP2 gene , SNPs rs12368653. I work on multiple...
23 September 2019 940 1 View
I am currently working with antioxidants in Yemeni honey, and I have a chemical I could not find. It does not exist in Yemen and I was wondering where I could acquire it. The substance I am in...
24 January 2013 5,707 13 View