Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

How much the nanoparticles reach the inflammatory tissue?

Dear colleagues, I want to know the average analysis data of EPR effect on inflammatory tissue (acute lung inflammation/injury, ischemia/reperfusion, rheumatoid arthritis, and sepsis..) In...

22 December 2020 3,147 2 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Exergy destruction mathematical calculation in kW?

somebody, please elaborate on how to calculate exergy destruction in kW units. from Aspen HYSYS I found mass exergy with kJ/kg unit and i don't know how to calculate it by using Aspen HYSYS and if...

25 November 2020 2,675 3 View

I am looking for the dataset to test the algorithms for Radar Emiiter Classification?

I am working on Radar Emitter Classifiers and I want test my codes. unfortunately I'm unable to find a dataset to test my algorithms. I'll be glad if someone can help me with this...

04 November 2020 3,988 3 View

How to link excel with Aspen plus?

Is there any way to connect excel data sheets with aspen plus as inputs to perform parametric analysis?? I want to change input parameters for a certain range to see system performance

28 October 2020 2,174 3 View

Resistor definition in Piezoelectric bimorph with ANSYS workbench

Hello, good day! I am trying to simulate similar bimorph piezoelectric harvester with below commands. However, the output power doesn't change with resistor value. Please help to find the reason. ET,10,CIRCU94,0 !SET UP RESISTOR R,1,100000 !RESISTANCE VALUE TYPE,10 !SET ELEMENT TYPE E,1,2 !CREATE RESISTOR BETWEEN NODES 1 AND 2 Thanks in advance Regards,

02 March 2021 0 0 View

No title

02 March 2021 3,060 3 View

How to define tie constraint between rigid body and another part in dynamic explicit model of Abaqus?

Hi dear researchers I connected a rigid body into the part of my structure by tie constraint and then I added displacement to rigid body, in static general step every thing is fine and these two...

28 February 2021 3,442 2 View

No title

28 February 2021 9,936 2 View

When is it unnecessary to change organisational culture?

As a former management practitioner, I recall a generally accepted view that changing organisational culture is difficult, so you should only attempt it if the organisational change that you are...

27 February 2021 2,595 8 View

Does RNAiMAX transfection reagent work in serum free medium?

I diluted siRNA and RNAiMAX in opti-MEM and added to the cells which they were in the growth medium. Is it a right way? or should I culture cells in the opti-MEM medium for a while and not in...

26 February 2021 10,041 3 View

What is the best surface to culture cells isolated from a skin biopsy?

Hello, recently I am having some difficulties with maintaining the cell culture of primary cells isolated from a skin biopsy (normal and malignant). The coating of culture plates with Matrigel (a...

26 February 2021 6,151 2 View

Unknown debris sheets observed in cell culture flasks?

Hi, We culture neural progenitor cells in T175 culture flasks coated with PLO-Laminin. We have successfully grown these cells with our protocol for months. Recently, we observed large sheets...

25 February 2021 3,443 4 View

Has anyone experienced changes in growth for cell culture when purchasing media from different companies?

I recently switched the company where we buy our DMEM/F12 and i have noticed a signficant change in growth for my human olfactory neurosphere cell lines

24 February 2021 2,268 3 View

Advice on growing lactobacillus species in the lab?

Hello everyone, For part of my PhD project, I'm hoping to grow some lactobacillus species in the lab so that I can create standard curves for a qPCR quantification of a faecal sample. However, I...

24 February 2021 3,157 6 View