Hi,
I sent some samples to a company to do whole genome sequencing (Illumina). Here below is an example of one of the fastq files I got from them. They told me that adaptors and barcodes have been already trimmed and that I just need to trim the V3-V4 primers: 16 bp for the fwd reads and 24bp for the reverse.
If the primers were still there, I would have expected to see their sequence on each reads, but I cannot see it. (also they did not disclose to me the primer sequence, I only know their length). Thanks
@A00197:374:HH5YWDSX2:3:1101:2067:1000 1:N:0:CTTGTACACC+AAGCGCGCTT GTTTTCAACCAACACTGGTTCGGGCCTCCATACGGTGTTACCCGTACTTCACCCTGGCCAAGGGTAGATCACCTCGCTTCGCGTCTATTCCCAGCGACTTGTCGCCCGTTTCGCACTCGCTAACGCTACGGCTCGCTAACGCTTAACCTC + FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFF:,FF:F,,,,FFFFF:::,FF,:F,FFF:,,FFF,:F:,F,F,F,,:F,:F,FFFF,F @A00197:374:HH5YWDSX2:3:1101:7925:1000 1:N:0:CTTGTACACC+TAGCGCGCTT AGACAAACCTGTCGAGTATGCGGTCCACATGCGGCGCCTACCTGCCGATCGAATGATGGACCGTCTGCTCGCCCGCGGACAGGTCACTGCGCCCATGGTCCGTCGGCTGGCGGAGAAGATGGCTCGCTTCCATGAGACGGCTGAGACGAG + FF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF @A00197:374:HH5YWDSX2:3:1101:9281:1000 1:N:0:CTTGTACACC+AAGCGCGCTT ATGCAGGCTGATTGTCTGCTTACGGCGATCAAATCCGCCCACAGACGATACGCCATACTTGGGATGACGCACCAGCGTCCCCCGTTTGAGACCCAGCGACCGCGTACCACCCTGCGGTCGTCTGATGCCGCCGTGTGCGAACTGCAGCAT + FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFF
Hi Valentina Vanghi , I would try running fastqc (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) or fastp (https://github.com/OpenGene/fastp) with your data - both should highlight adapters and overrepresented sequences at the beginning and end of reads and will give you an idea of how much you should maybe trim - hope that helps!
I think you are looking for somehting like
Forward primer: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’
Reverse primer: 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’
As Rishi mentioned you can use fastp to check if you have some overrepresentation of particular sequences, and then add the sequences in a list of adapters and use trimmomatic (http://www.usadellab.org/cms/?page=trimmomatic) or AdapterRemoval (https://adapterremoval.readthedocs.io/en/stable/) to trim them from your reads.
Hi sorry I forgot to mention that I have run a fastqc analysis on the files and it fails the "adapter content" part because of Nextera transpostase seq, which is why I contacted the company and asked what to do.
They said "The adaptors and bar codes were trimmed. What you will need to trim is the primers. Use the trimLeft argument in the filterAndTrim function of dada2. The size of the V3-V4 primer used are 16 for forward and 24 for reverse."
The problem is that to use this function I also need the un-trimmed files which I do not have. I only have the files with barcodes and adaptors removed already (they only sent me those).
- If the primers have not been trimmed, why I cannot see them on my reads?
- How to remove these Nextera seq if I only have their length and not their sequences?
- Is there another tool that I can use just specifying the length of the seq to trim, other than dada2 (because dada2 requires the original raw data, that I do not have)?
I will try to use fastp... maybe I can get the sequences of the Nextera sequences?
Thanks!
- Badges
- Science method