Hi all,
I have primers for ChiP analysis in my lab.
Before I start the experiments, I'd like to check this is really target for p16INK4A gene (CDKN2A).
Q1. How can I check the target promoter of this primers?
Origine: Mus Musculus (Mouse)
Forward (5'-3'): GATGGAGCCCGGACTACAGAAG
Reverse (5'-3'): GCTCCAAACAATGACAGAGAAC
Q2. Actually p16INK4A and p19 mRNA shared really similar sequences, and they are all encoded in CKDN2A gene. Is it possible to design the specific mRNA (p16 or p19, not both) targeting primers?
Thanks a lot :)
Hi So-jin, to give you a couple of ideas if you have not tried...
I will first check that your primers hybridase in the genome or not and secondly if they are complementary to regions that you defined as promoter regions of your gene.One way to check it out is using UCSC insilico PCR and see if you have your desired match. If there is a match, you will get the sequence lying between the primers in fasta format, and the chr and start and end positions so you cna go straight to the browser and see what is the gene landscape around these coordinates. https://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=667515281_gTwBSpaqoWMVl1KVnkUYZ6F8pa3q&org=Mouse&db=mm10&wp_target=genome&wp_f=GATGGAGCCCGGACTACAGAAG&wp_r=&Submit=submit&wp_size=4000&wp_perfect=15&wp_good=15&boolshad.wp_flipReverse=0.
For your second question maybe you could check the similarity between the genomic sequences, use the fasta genomic sequences and run a multi-alignment and focus in designing primers recognising at least partly a region unique on each of them.
Best,
Use NCBI/primerblast to check your primers if it targets your gene or not.
Best ragards
Hi @Mar Muñiz Moreno,
Thank you for you answer.
As your comments, I tried to find the target sequence of my primers.
Unfortunately, there is no matches for my primers.
But I'm not sure I selected right option for checking the primers.
I've attached the pics of my options and result.
Best,
FYI, I also checked the sequence in ensemble.org, but I couldn't find the target sequence (http://useast.ensembl.org/Mus_musculus/Gene/Sequence?db=core;g=ENSMUSG00000044303;r=4:89274471-89294653).
Does it mean that this primer doesn't target cdkn2a promoter?
Hi So-jin , sorry as I did not see your answer … I dont know if you have any solution already but just in case …Yes it seems like your primers are not targeting any sequence in the genome. To be sure I also checked switching the F and R primers too as your gene is on the reverse strand but no matches were found.
Also keep on mind that there is not a consensus in how to define the promoter region, some use -1kb +1kb from TSS, 1kb-500bps upstream from TSS, -100bps to +100 bps … but it depends. If you check in ENSEMBL you should customize the view to show this expanded region. Similarly for primerblast to work you should introduce all the possible fasta sequence not only the fasta of the gene will be enough if your primers are or at least one of them, outside of the gene region . Dont you have any further information about the region these primers where supposed to hybridate or how they defined promoter to design the primers?? the fasta sequence used to design them or the program used ? If not maybe your better choice will be to design the primers form scratch on your own this post can help you with it . https://www.researchgate.net/post/How_to_design_a_primer_for_the_promoter_region
Best,
Mar
- Badges
- Science method