BLAST the 2 primer sequences at NCBI and you will get a number of good hits for perfect homology. 2 of these will be on the same chromosome in different orientations within about 1000 bases of each other. Subtract the base position of the 5' base on each primer and you will have the size of the amplimer.

Hello, it is so easy :

First : go to https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch

Second : enter your primer and forward sequences primer in the top box with following format : "forwardprimernnnnreverseprimer" example : "ACATGCCGTCACCnnnnCACTTGAATTGCAC"

please bear in mind that reverse primer must be entered as the reverse complement. You can use http://reverse-complement.com/

Third : click blast button at the bottom and wait until the result appear.

fourth : click the top one in the result as it has the most similarity. Than just substracting the range1-range2.

It is very helpful : https://www.youtube.com/watch?v=04t6PbopFas

Hi,

If your target is the human genome, it will be better to check the primers via in silico PCR (https://genome.ucsc.edu/cgi-bin/hgPcr). There, after entering the primers, you can choose the appropriate parameters for your PCR and run a figurative PCR and see the possible product(s). I've found this more practical than blast server of NCBI.

Good luck :)

If you know the nucleotide position of the forward primer and that of the reverse primer you simply subtracte them to get the PCR bp product. So, if forward primer position is 1001-1023bp and that of the reverse is 1400-1380bp then the PCR product will be 400bp.

Thanks Lantip for your answer. Thanks Maryam for the information 

Thanks Dr. Serag. I got the position of the primers from blast so it will be easy to determine the target bp.

If you know the nucleotide position of both the primers, than the distance between them is expected amplicon size. If not, BLAST analyse both the primers in NCBI and check the gene sequence to which both primers has hits. In that particular gene sequence, locate where exactly the forward and reverse sequence is present. Now count the number of nucleotides present in between.  

Hello!

We have designed primers,  which were used for a PCR reaction. We obtained a PCR product size of about 1180 pb (even for the positive control). when sequencing those PCR products, they correspond to the cibled gene.

The problem is when I check the insilico expected size either by alignement or one of the technics suggested above or by using the next program which is so useful as well (http://www.bioinformatics.org/sms2/pcr_products.html). the expected size was completely different (it was about 1395 pb?!

Can someone help me to solve that?

Hello, it is very easy

in simple words you can subtract position of reverse primer from forward primer pluse 1 in the matching of intended gene location will obtain amplicon size in bp.

Hint// all opinions of researcher are expirt

good luck

Hanane Djenane

if you just use primers for PCR reaction i.e gene detection you can send me you gene (s) and I will design a suitable primer, but if you use primers for SNP the design is govern in a restricted condition.

or even you can sen the primers which you are designed to check by me or any other researchers

good luck and be hopeful 

 Charith Raj Adkar-Purushothama

sir i did it but i tells almost  525 in my sequence but when i do it using any software the answer is 473 for my sequence,,, why is it so?

possibly one of your primers can anneal further inside the expected site if the annealing temperature is too low in pcr. Alternatively the amplimer has 2 regions of homology and forms a loop so  runs at an unexpected size in agarose gel. If you blast the sequenced amplimer does it match exactly the expected gene or is there a gap in the sequence and have you checked that the primers were designed off the same species as was used in the blast search. When you sequenced was it from both ends as you do not get sequence of the primer or within about 30 bases of the primer with Sanger sequencing so if you only sequence from one end it will always look too short

Thanks Prof Rutland for the nice contribution

You may primer blast:

https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome

add accession number. and then you can find PCR product size and other info.

http://www.bioinformatics.org/sms2/pcr_products.html

the above site you can enter and can calculate the exact product size of the selected primers, you should get the whole gene sequence from the NCBI 

Thanks Dr. Danial

While designing PCR primers make sure whether DNA or RNA sequence is used. If you use RNA sequence for designing the primers and try to amplify DNA by PCR, you might expect longer length than expected because DNA contains introns.

 Thanks Zanan

I recommend this website.

http://rohsdb.cmb.usc.edu/GBshape/cgi-bin/hgPcr

you just text forward and resever primer, then submit it.

Good luck

http://rohsdb.cmb.usc.edu/GBshape/cgi-bin/hgPcr

This website isn't designed for all organisms. For example, plants are absent.

Hi, I have primer annealing temperature which is 52°c and pcr product 1000bp but I don't know which program I can use to do it?

BLAST the sequences of both primer within available gene sequence and you will get a number of amplifier after the calculation of base sequences between the primers .

Hi, first of all you can calculate the amplicon by many methods, but if need to calculation depending primer sequence you can apply the equation as bellow

amplicon size (bp)= Reverse primer position in genome - Forward primer sequence in genom + 1

sure you can making matching for your primer in the general sequence of your intended gene

Thank you

Hi Ramadan!

This video will help you a lot https://www.youtube.com/watch?v=rlK-5joOlyU

A very fruitful dicsuccsion

The in silico PCR function of genome browser is even easier for this purpose, just enter the sequence of your primers and it will give you the sequence of the final PCR product directly:

https://genome.ucsc.edu/cgi-bin/hgPcr

Paul Rutland

Hi, you told " 2 of these will be on the same chromosome in different orientations within about 1000 bases of each other. "

In my case I have this set:

Froward: GGTGGTGTMGGDTTCACMCARTA

Reverse: CGTTCATBGCGTAGTTVGGRTAGT

but I could not find the same chromosom.

Do you have any suggestion?

Please you put your answer Lantip Rujito too.

Thanks

Mehrdad Rabiei

what species does this amplimer come from please as most of the perfect hits are from archea clones and look like methyl coenzyme m reductase but to get the right size we need the species. The paper that the primer sequence came from probably also gives the amplimer size

• Paul Rutland yes are right! but the PCR ptoduct length not to provided.
• the paper:
• https://aem.asm.org/content/74/21/6663

ok if we blast against Methanolobus profundi strain in NCBI particularly strain

NZ_FOUJ01000003.1 the primers amplify a 489 base product. Other species may have small insertions or deletions but I expect most to be around this size Mehrdad Rabiei

Paul Rutland

Thanks alot.

What/why Methanolobus profundi strain in NCBI particularly strain NZ_FOUJ01000003.1 attarcted your attention to?

What factors led you to predicct the small insertions or deletion?

These questions' answers are of most importance to me.

Mehrdad Rabiei

There was no reason to choose that strain. This is a gene sequence and most genes are conserved because they are useful to the host so I just chose one of many dozens of strains that have similar sequences as an example. You will choose the one that you are interested in but this was an example. Concerning the amplimer size you asked for an amplimer size and some species may have small changes of sequence so I was just warning you that there may be some small variation if you are sequencing this amplimer. There is no proof of this but as this sequence is being used by other researchers for phylogeny work there should be plenty of changes within its structure otherwise all organisms would look the same at this locus and it would not be useful in this kind of analysis.

Thanks for the clear reply, dear Paul Rutland

Just a small question!

As you might saw in the BLAST page, the first alignment showing a higher similarity indicated too far distance between the two primers (F&R), I mean, it does not make sence that would be a right choose.

Regarding the others' variations, sometime they are small or sometimes greater, as you aware. My question is how to pick one up among the small variations, those are on three to ten nucelotides scale?

By the way, I want to know what is the PCR product length of primer set used in the paper. If the length is my desire, I will take it to use in my project; that's why, I insist on to catch an accurate and greater understanding of our discussion.

By the way, with full of respect, a friend recently showed me a quite similar forward primer of the selected primer with a tiny modification, which bind to the same region.

Article Activation of Methanogenesis in Arid Biological Soil Crusts ...

https://journals.plos.org/plosone/article/file?type=supplementary&id=info:doi/10.1371/journal.pone.0020453.s009

The PCR product is 469 pb. So, the product length you presented is 489 bp. The difference between them is 20 bp. In sequencing the 20 bp does matter!

How to fix the issue? Although I think I need to rely on the paper, I wanted to catch the similar result from the Blast.

Hi,

Go to https://www.researchgate.net/deref/https%3A%2F%2Fblast.ncbi.nlm.nih.gov%2FBlast.cgi%3FPAGE_TYPE%3DBlastSearch

https://genome.ucsc.edu/cgi-bin/hgPcr

Go to NCBI Nucleotide Blast, in the "Enter accession number(s), gi(s), or FASTA sequence(s) box"

Type your forward primer sequence followed by four "n" and your reverse primer sequence. Let's write  your Forward Primer sequence is :

Forward Primer: TGACTATTCTCACGATTGGACTG [Enter your Forward Primer Sequence] Reverse Primer: CACGACTAGCGCCATTGTTA [Enter your Reverse Primer Sequence]

In the FASTA sequence box Enter the primer sequence in this format:

"TGACTATTCTCACGATTGGACTGnnnnCACGACTAGCGCCATTGTTA" "your Foward primer sequencennnnyour Reverse primer sequence"

Press on BLAST and wait for the result screen to come.

You will get the BLAST Result Screen

Click on the first link (the one with the highest matching % from the list).

By substracting the lower sequence number value of the forward strand from the lower sequence number value of the reverse strand you can find out the PCR product length.

In this case,

pirA Seq : 47545-47281= 264 bp (PCR product length)