I used NCBI for designing the primer which I need, but I want to know how can I calculate the annealing temp. of it ?
this is the primer that I want to know its annealing temp.?
Forward primer CAGGGCAGCAAGGTGTTTTC
Reverse primer TTGGTGGGTTGCCTGATACC
Hi,
Thermofisher has a calculator which might be useful for you to get an estimate of the annealing temperature for your primers:
https://www.thermofisher.com/za/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html
Hope that helps.
Hi,
ApE (A plasmid editor) is able to predict a temperature (Tm) for a given sequence. I usually take this value as annealing temperature in my PCR and it is almost always working very well.
Good luck with your PCR!
Hi Gadalla,
You should use NEB tool for annealing temperature calculation.
http://tmcalculator.neb.com
This gives you option to select the type of polymerase and buffer you are using and accordingly calculates annealing temperature.
Hi,
As you see there are a lot of options to calculate Tm. Even primer blast gives you a Tm. However, you must keep in mind all of them are just predictions and you need to do the experiment to really now it.
People usually recommend to start with a Tm a couple of ºC below the calculated Tm.
Good luck,
Alfonso
Hi,
There are multiple factors that effect the annealing temperature of primers in PCR. It is primarily dependent on the Tm of Primers. Primer Tm can be calculated using any of the multiple tools available on the internet. The annealing temperature is usually taken as 5ºC below the Tm of the lower Tm primer. However, it also depends on the Polymerase enzyme and buffer system that you use. The tools by Thermofisher and NEB allow calculation of the Annealing Temperature according to the enzyme and buffer to be used. Additionally, if the PCR reaction requires addition of DMSO, the annealing temperature will reduce.
Moreover, the best annealing temperature for your set of primers can also be optimised by PCR using a Temperature Gradient.
Hope this helps.
Good Luck.
Hi,
OligoAnalyzer 3.1 is a primer analysing tool from integrated DNA technologies. You can use below-given link to check your primer Tm, Hairpin, Self-Dimer, Hetero-Dimer and Tm-Mismatch.
http://sg.idtdna.com/calc/analyzer
Hope, this is helpful for you.
Best of Luck !
Thank you
You may use any of the programs available, but may also run some systematic tests with different temperatures - especially higher temperatures to increase and optimize the specificity.
Some links
https://eu.idtdna.com/pages/support/technical-vault/faq/browse-all-questions-answers/how-do-you-calculate-the-annealing-temperature-for-pcr-
https://www.thermofisher.com/in/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/tm-calculator.html
http://www.protocol-online.org/biology-forums-2/posts/28868.html
at the end of day, nothing beats a Gradient PCR, and you'll be surprised which is the best temp. for you.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology